C

Christian Zahnd

University of Zurich

Publishes on Monoclonal and Polyclonal Antibodies Research, Glycosylation and Glycoproteins Research, RNA and protein synthesis mechanisms. 18 papers and 1.9k citations.

18Publications
1.9kTotal Citations

Is this you? Claim your profile.

Add your photo, update your bio, and get notified when your ranking changes.

Top publicationsby citations

A label-free immunosensor array using single-chain antibody fragments
Natalija Backmann, Christian Zahnd, François Huber et al.|Proceedings of the National Academy of Sciences|2005
Cited by 277

We report a microcantilever-based immunosensor operated in static deflection mode with a performance comparable with surface plasmon resonance, using single-chain Fv (scFv) antibody fragments as receptor molecules. As a model system scFv fragments with specificity to two different antigens were applied. We introduced a cysteine residue at the C terminus of each scFv construct to allow covalent attachment to gold-coated sensor interfaces in directed orientation. Application of an array enabled simultaneous deflection measurements of sensing and reference cantilevers. The differential deflection signal revealed specific antigen binding and was proportional to the antigen concentration in solution. Using small, oriented scFv fragments as receptor molecules we increased the sensitivity of microcantilevers to approximately 1 nM.

Efficient Tumor Targeting with High-Affinity Designed Ankyrin Repeat Proteins: Effects of Affinity and Molecular Size
Christian Zahnd, Martin Kawe, Michael T. Stumpp et al.|Cancer Research|2010
Cited by 246

Slow-clearing, tumor-targeting proteins such as monoclonal antibodies typically exhibit high tumor accumulation but low tissue contrast, whereas intermediate-sized proteins such as scFvs show faster clearance but only moderate tumor accumulation. For both, tumor targeting does not seem to improve further above an optimal affinity. We show here that with very small high-affinity proteins such as designed ankyrin repeat proteins (DARPins), these limits can be overcome. We have systematically investigated the influence of molecular mass and affinity on tumor accumulation with DARPins with specificity for HER2 in SK-OV-3.ip nude mouse xenografts. DARPins with a mass of 14.5 kDa and affinities between 270 nmol/L and 90 pmol/L showed a strong correlation of tumor accumulation with affinity to HER2, with the highest affinity DARPin reaching 8% ID/g after 24 hours and 6.5% ID/g after 48 hours (tumor-to-blood ratio >60). Tumor autoradiographs showed good penetration throughout the tumor mass. Genetic fusion of two DARPins (30 kDa) resulted in significantly lower tumor accumulation, similar to values observed for scFvs, whereas valency had no influence on accumulation. PEGylation of the DARPins increased the circulation half-life, leading to higher tumor accumulation (13.4% ID/g after 24 hours) but lower tumor-to-blood ratios. Affinity was less important for tumor uptake of the PEGylated constructs. We conclude that two regimes exist for delivering high levels of drug to a tumor: small proteins with very high affinity, such as unmodified DARPins, and large proteins with extended half-life, such as PEGylated DARPins, in which the importance of affinity is less pronounced.

Directed in Vitro Evolution and Crystallographic Analysis of a Peptide-binding Single Chain Antibody Fragment (scFv) with Low Picomolar Affinity
Christian Zahnd, Silvia Spinelli, Béatrice Luginbühl et al.|Journal of Biological Chemistry|2004
Cited by 185Open Access

We generated a single chain Fv fragment of an antibody (scFv) with a binding affinity of about 5 pm to a short peptide by applying rigorous directed evolution. Starting from a high affinity peptide binder, originally obtained by ribosome display from a murine library, we generated libraries of mutants with error-prone PCR and DNA shuffling and applied off-rate selection by using ribosome display. Crystallographic analysis of the scFv in its antigen-bound and free state showed that only few mutations, which do not make direct contact to the antigen, lead to a 500-fold affinity improvement over its potential germ line precursor. These results suggest that the affinity optimization of very high affinity binders is achieved by modulating existing interactions via subtle changes in the framework rather than by introducing new contacts. Off-rate selection in combination with ribosome display can evolve binders to the low picomolar affinity range even for peptide targets. We generated a single chain Fv fragment of an antibody (scFv) with a binding affinity of about 5 pm to a short peptide by applying rigorous directed evolution. Starting from a high affinity peptide binder, originally obtained by ribosome display from a murine library, we generated libraries of mutants with error-prone PCR and DNA shuffling and applied off-rate selection by using ribosome display. Crystallographic analysis of the scFv in its antigen-bound and free state showed that only few mutations, which do not make direct contact to the antigen, lead to a 500-fold affinity improvement over its potential germ line precursor. These results suggest that the affinity optimization of very high affinity binders is achieved by modulating existing interactions via subtle changes in the framework rather than by introducing new contacts. Off-rate selection in combination with ribosome display can evolve binders to the low picomolar affinity range even for peptide targets. Directed evolution of proteins in vitro has become a widely applied strategy to generate proteins with a desired property (1Amstutz P. Forrer P. Zahnd C. Plückthun A. Curr. Opin. Biotechnol. 2001; 12: 400-405Google Scholar). Especially in the generation of high affinity binders, the iterative succession of randomization and selection was shown to efficiently mimic natural affinity maturation. The success of this approach is dependent on the size and the quality of the library and the power of the selection method used. Technologies that work entirely in vitro such as ribosome display (2Hanes J. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4937-4942Google Scholar) and mRNA display (3Roberts R.W. Szostak J.W. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12297-12302Google Scholar) are more favorable than methods that work partially in vivo such as phage display (4Smith G.P. Virology. 1988; 167: 156-165Google Scholar) or fully in vivo such as the yeast two-hybrid system (5Fields S. Song O. Nature. 1989; 340: 245-246Google Scholar) or the protein complementation assay (6Mössner E. Koch H. Plückthun A. J. Mol. Biol. 2001; 308: 115-122Google Scholar) as the in vitro technologies do not need transformation of cells after each new round of randomization. Therefore, they allow the handling of much larger libraries and more cycles of randomization, and the experimental work is accelerated greatly. A prerequisite of any evolution is randomization between different selection rounds. In ribosome display this is facilitated by the use of linear DNA. The randomization occurs at a low rate by the intrinsic error rate of the polymerase used but can be enhanced by error-prone PCR (7Zaccolo M. Gherardi E. J. Mol. Biol. 1999; 285: 775-783Google Scholar), by DNA shuffling (8Stemmer W.P. Nature. 1994; 370: 389-391Google Scholar), or both, thereby generating highly diverse pools. While the generation of binders having binding constants in the subnanomolar range can be achieved, e.g. with synthetic antibody libraries and established techniques (9Knappik A. Ge L. Honegger A. Pack P. Fischer M. Wellnhofer G. Hoess A. Wölle J. Plückthun A. Virnekäs B. J. Mol. Biol. 2000; 296: 57-86Google Scholar), the generation of very high affinity binders with binding constants in the lowest picomolar affinity range is difficult for several reasons. First, a very stringent selection pressure must be applied to separate improved binders from the already very high affinity precursors. Second, selected binders must be eluted efficiently, which may become very difficult for binders with very slow off-rates. Here ribosome display offers a significant advantage since bound binders must not be eluted, but the ribosomally bound mRNA can be recovered by the addition of chelating agents, which destabilize the ribosomal complex (1Amstutz P. Forrer P. Zahnd C. Plückthun A. Curr. Opin. Biotechnol. 2001; 12: 400-405Google Scholar). In particular the generation of very high affinity peptide binders is made difficult by the relatively high flexibility of the peptide in the unbound state and the corresponding loss of entropy upon binding. This is less of a problem for comparatively rigid antigens such as hydrophobic small molecular weight compounds for which subpicomolar binders are known (10Boder E.T. Midelfort K.S. Wittrup K.D. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 10701-10705Google Scholar). We applied a competitive selection for increased off-rates to affinity mature a high affinity peptide binder previously selected with ribosome display from a murine library (11Hanes J. Jermutus L. Weber-Bornhauser S. Bosshard H.R. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14130-14135Google Scholar). The peptide was derived from the yeast transcription factor GCN4. We constructed different mutants of a high affinity binder and generated from them second generation libraries using DNA shuffling and error-prone PCR. From these libraries we successfully isolated binders in the low picomolar affinity range. By determining the crystal structure both in the free and antigen-bound state we could show that the gain in affinity of 500-fold, compared with its likely germ line precursor, was almost exclusively a result of second sphere mutations not being in direct contact with the antigen. These findings may have great impact on future library design and affinity maturation strategies. Expression and Purification of Single Chain Fv Fragments—The scFv 1The abbreviations used are: scFv, single chain Fv fragment; VL, variable domain of the light chain; VH, variable domain of the heavy chain; 8-oxo-dGTP, 8-oxo-2′-deoxyguanosine 5′-triphosphate; dPTP, 6-(deoxy-β-d-erythro-pentofuranosyl)-3,4-dihydro-8H-pyrimido-[4,-5c][1,2]oxazine-7-one-5′-triphosphate; RIA, radioimmunoassay; CDR, complementarity-determining region. genes were cloned into the periplasmic expression vector pAK400 (12Krebber A. Bornhauser S. Burmester J. Honegger A. Willuda J. Bosshard H.R. Plückthun A. J. Immunol. Methods. 1997; 201: 35-55Google Scholar) introducing a His6 tag, expressed in Escherichia coli SB536 (13Bass S. Gu Q. Christen A. J. Bacteriol. 1996; 178: 1154-1161Google Scholar), and purified by immobilized metal ion affinity chromatography and subsequent antigen affinity chromatography as described previously (11Hanes J. Jermutus L. Weber-Bornhauser S. Bosshard H.R. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14130-14135Google Scholar). For structure determination, a seleno-Met-containing variant of clone H6 was grown in 1 liter of M9 minimal medium to an OD600 of 0.6. An amino acid mixture containing 100 mg/liter each of Lys, Thr, and Phe and 50 mg/liter each of Leu, Ile, Val, and seleno-Met was added. After 1 h, isopropyl-1-thio-β-d-galactopyranoside was added to a final concentration of 1 mm for expression overnight. The protein was purified as described above. The Library Construction—The scFv fragments C11L34, L24, L107, L135, L107–135, H6, and H67 in the vector pAK400 were PCR-amplified using primers SDAla+ (5′-AGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATATCCATGGCGGACTACAAAGAT) and Sfi_rescue (5′-GCCCTCGGCCCCCGAGGC). A total of 1 μg of PCR product of an equimolar mixture of all clones was used for DNase I shuffling (14Adey N.B. Stemmer W.P.C. Kay B.K. Kay B.K. Winter J. McCafferty J. Phage Display of Peptides and Proteins. Academic Press, Cambridge1996: 280-292Google Scholar) as described previously (15Jermutus L. Honegger A. Schwesinger F. Hanes J. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 75-80Google Scholar). Some of the reassembled PCR products were further randomized by error-prone PCR using primers SDAla+ and Sfi_rescue. Error-prone PCR was performed using the dNTP analogues 8-oxo-dGTP and dPTP according to Ref. M. Gherardi E. J. Mol. Biol. 1999; 285: 775-783Google with small cycles of error-prone PCR were performed in the of dPTP, 8-oxo-dGTP, and 50 and The final rate after DNase I shuffling and error-prone PCR and the of the mutations were by about A was to the library as described (11Hanes J. Jermutus L. Weber-Bornhauser S. Bosshard H.R. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14130-14135Google Scholar). for library was and in vitro as described in Ref. J. Jermutus L. Weber-Bornhauser S. Bosshard H.R. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14130-14135Google The of and proteins were with 1 peptide C. Weber-Bornhauser S. J. Hanes J. Plückthun A. Bosshard H.R. 1999; Scholar) at overnight. was into and only to 1 was added. The were for a which was increased from round to with in the round and to after the round in a at The were recovered by binding to for The were and the was eluted and purified as described in Ref. J. Jermutus L. Weber-Bornhauser S. Bosshard H.R. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14130-14135Google of and Single by and the analysis of single the selected were cloned into L. A. Pack P. C. Plückthun A. Press, Scholar). of single clones was from the were from a PCR were performed as described previously A. Zahnd C. Fischer F. S. Honegger A. C. Plückthun A. A. J. Biol. Scholar). were using the method on a L. A. Plückthun A. 1996; Scholar). The purified protein was to 1 and with different of antigen at The were over a which was to with the antigen used for The of the in the linear was the concentration of antigen. was from at as described previously (11Hanes J. Jermutus L. Weber-Bornhauser S. Bosshard H.R. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14130-14135Google Scholar). of clone H6 in complex with the antigen and clone in the of the peptide were obtained using the of 1 of the Fv were with 1 of the mm after at to and and J. Mol. Biol. of the complex of H6 and the peptide were obtained by the scFv and the peptide in a of 1 complex were with 1 of a containing The was with complex and a protein of and of the free scFv fragment were at 100 on a on a using the were using and they to and were performed using in Academic Press, Scholar) and Biol. 1994; Scholar). A crystal of the complex was with were at 100 in the at the The was performed with Biol. 1994; Scholar). The of the complex were with Biol. 1994; Scholar) in using the The for the free scFv and the complex were and The of the are shown in and of of of of on on in a new and were by molecular Scholar) using the J. S. of the and Scholar). and were performed using the murine Fv for the The structure of the Fv was used to the structure of the The molecular for the Fv an of and of the for the complex were and between and was performed with P. R.W. J. M. Biol. 1998; Scholar) using by Biol. 1997; Scholar) using and After each a new was and the was with A. C. Scholar). are in The and structure of the free and Fv have in the at for as and Library a we selected a of scFv fragments from a murine library by using ribosome a selection method that entirely in vitro and the selection from very libraries The selected scFv fragments bound with very high affinity to the peptide derived from the yeast transcription factor (11Hanes J. Jermutus L. Weber-Bornhauser S. Bosshard H.R. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14130-14135Google C. Weber-Bornhauser S. J. Hanes J. Plückthun A. Bosshard H.R. 1999; Scholar). The affinity an affinity of pm and a amino acid ribosome display that to a affinity improvement compared with its likely from the murine (11Hanes J. Jermutus L. Weber-Bornhauser S. Bosshard H.R. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14130-14135Google Scholar). We constructed a second generation library in First, we generated different mutants of the high affinity clone and a on mutations that in the selection and and These mutants were as a for the of second generation The was generated by using DNA shuffling of all clones C11L34, thereby all mutations (8Stemmer W.P. Nature. 1994; 370: 389-391Google Scholar). were generated by the use of error-prone PCR. was generated by error-prone of C11L34, and was generated by the combination of the the mutants were by error-prone PCR and to DNA of the mutations and of different clones were in a selection and mutations compared with were by H6 and were constructed was shown that the on H6 is for and affinity these clones were used for the generation of different libraries by DNA shuffling and error-prone PCR with the of clone which was constructed at a in the The clones were the directed evolution and showed in a mutations are in the were by The affinity improvement the directed evolution was by was to have a single compared with its likely clones are derived from and its For its is in the and was not The clones were in a selection (11Hanes J. Jermutus L. Weber-Bornhauser S. Bosshard H.R. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14130-14135Google Scholar), and mutations compared with were by H6 and were constructed was shown that the on H6 is for and affinity A. Plückthun A. J. Mol. Biol. 2001; S. S. B. Honegger A. L. C. Plückthun A. J. Mol. Biol. 2001; Scholar). these clones were used for the generation of different libraries by DNA shuffling and error-prone PCR with the of clone which was constructed at a in the The clones were the directed evolution and showed in a The mutations are in the A. Plückthun A. J. Mol. Biol. 2001; The were by The affinity improvement the directed evolution was by was to have a single compared with its likely (11Hanes J. Jermutus L. Weber-Bornhauser S. Bosshard H.R. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14130-14135Google Scholar). clones are derived from and its For its is in the K.S. C. of of of of and Scholar) and was not in a new the rate of the we used high of the analogues 8-oxo-dGTP and dPTP to (7Zaccolo M. Gherardi E. J. Mol. Biol. 1999; 285: 775-783Google Scholar). The final of the were as for for and for into that mutations are or have on e.g. they are in the or the we that the randomized have to amino acid a of the randomization we that mutations that were an PCR were more in the final This of mutations could be in future by the use of a high concentration and very high error thereby the final rate Display and Off-rate ribosome all libraries to be to a protein derived from to allow the protein to (15Jermutus L. Honegger A. Schwesinger F. Hanes J. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 75-80Google Scholar). by be to between binders with different all in the picomolar we used a competitive selection for off-rates. The ribosomal after in vitro were with a 1 of antigen. A of antigen was and the were at from the antigen, to which they were be by the and be bound to the of with is the of the The was from round to round and thereby the selection After selected mRNA was isolated and and the were to DNA The was further randomized after the second round using the as in round the mRNA of which generated by error-prone of only but which not to DNA could not be after the round of This the of in with high to a of the in an the off-rate selection the of the ribosomal which can more than at of the after Off-rate round of ribosome the were for improved binding by A. Zahnd C. Fischer F. S. Honegger A. C. Plückthun A. A. J. Biol. Scholar). The were expressed in vitro in the of with different of free antigen, and to to antigen. The of antigen to the binding of the scFv fragments to antigen with the affinity of binders in the and from round to round In the error-prone randomized even high of not binding of the to the After of off-rate antigen was to of the from binding to the compared with the that the affinity of the binders in the improved compared with clone The total of the from round to that the of binders from round to round to the very stringent selection for the and were of single were and in vitro expressed protein was by of clones showed a significant binding to the antigen in the of of these clones could be with antigen. of them were at even than and were as affinity In which was generated by DNA of clones showed binding to the antigen after the round of directed but only an improved a few improved that them the applied selection the of and to the the of binders over a round was After this of clones showed binding to the antigen, of which showed improved compared with the of the in the increased by a factor of a of the binders in the over the a round after off-rate selection may be in to the selected of the with clones the were an of to amino acid to mutations derived from DNA The mutations were over both and mutations showed several is likely that they were since they different the only in from the clones used for DNA mutations were in framework affinity of all clones generated by and used for the library was In the binding of the clone the after off-rate selection was clones were expressed in the of E. coli and purified by immobilized metal ion affinity chromatography and antigen affinity chromatography A. Zahnd C. Fischer F. S. Honegger A. C. Plückthun A. A. J. Biol. Scholar). The of the purified proteins was in by analysis L. A. Plückthun A. 1996; 1994; P. 1997; Scholar). The constants of the clones used for the library generation were between and 50 pm and showed a improved affinity of and Therefore, we constructed the an affinity of this clone not the library was The of the clones were by The affinity of the clone with the was was in after the and its affinity in was to be pm by the competitive method (11Hanes J. Jermutus L. Weber-Bornhauser S. Bosshard H.R. Plückthun A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14130-14135Google Scholar). were in of in this range is very The minimal concentration of the scFv that could be using was about 1 to the very high this is much the at which concentration the have performed even the of this affinity binder be with from several protein a improvement of the scFv over the can be The of and were by analysis with very low and the were not The of the crystal structure of was in the of the antigen to and the crystal structure of variant H6 in the of the antigen was to The and the the variable were not in the as is for scFv The of of the scFv in complex with the peptide was to the complex with the acid peptide used for selection were not with that the peptide a C. Weber-Bornhauser S. J. Hanes J. Plückthun A. Bosshard H.R. 1999; Scholar) in the which that not more than amino of the peptide be by the Therefore, we used a peptide of amino for a second this approach were the structure was the peptide was to in a thereby its total contact than Therefore, not all of the can be in the the potential binding the peptide was at its and the corresponding which we to in to the of the to were in an into the We the which to the that the bound peptide a C. Weber-Bornhauser S. J. Hanes J. Plückthun A. Bosshard H.R. 1999; Scholar). From the of the scFv compared with the scFv bound to the peptide we to the of the peptide bound to the the peptide in was the of the peptide in complex with the scFv, originally as was very and not allow a not The antibody originally a variant of the of the yeast transcription factor in which were to C. Weber-Bornhauser S. J. Hanes J. Plückthun A. Bosshard H.R. 1999; Scholar). The of the peptide that is for the almost of the peptide in complex with the scFv that the is further by binding to the to of the Fv structure in the antigen-bound and free state results in a of only are between and and they are to the of the of in the structure of the These changes to the binding are not to the complex A was in and by and this is in both is that the is by the binding of the peptide to the scFv, by these only small changes in the are upon peptide which are all less than 1 peptide the of the scFv a small to each by This may allow a more binding The of the scFv with the scFv a and of in to which all The of the is by the relatively short of the heavy and light The are by the of and of both The antigen as an almost in the binding This binding of the antigen results in a of which to of the total of the the peptide in its into the binding by the in an of about which is than the between the light chain and the heavy chain This is larger than between fragments in complex with proteins J. Mol. Biol. 1996; Scholar). The is made by a great of between the scFv and exclusively the of the The peptide the scFv with the that is for the in the natural protein Scholar). of the of the peptide is by a hydrophobic with the of a to and is further by a hydrophobic contact to The is between and and on the a with The with the of that of The of is likely by a to In a contact to the of via a An is made between and A great of hydrophobic of and of are The of and hydrophobic on the of the peptide is by the of the scFv to the of the of the peptide and are in interactions between the peptide and the antibody The in is by A of the all the mutations that the high affinity binder are mutations, which do not with the antigen and via The which to a improved affinity of to all its and in the selection with ribosome is at from the antigen. The light chain of is of murine germ line of this a at this in murine light of and are In murine light make a to of VH, the is rather in binders, having a binding the is made to the In the of C11L34, an and a to the of the which is for a of This likely the flexibility of which is with the a hydrophobic contact between and In the in the to the chain may allow a more favorable domain A of the scFv in the antigen-bound and unbound state a domain upon antigen binding and a of the which to than in the unbound In addition to mutations, and that showed the off-rate selection in to on of the light chain and These mutations are to the of the is likely that the mutations the domain or domain and thereby the binding The improved the by a factor of to pm compared with clone This is much to with the antigen and must its by range interactions or the or flexibility of a or a While the free scFv a at H6, the structure of the scFv in complex with the peptide is a variant at this H6 was shown to the of the of the heavy chain A. Plückthun A. J. Mol. Biol. 2001; Scholar). The of the in the free state is as was for a In the this of the structure is Therefore, the of this was to The a or a than the of which are The only the selection that may with the antigen was by the library likely a to this of the peptide was not used for mutations directed evolution are on the of the scFv and may be could have such as which was in the affinity We have a of single chain Fv antibody fragments a which a in but a in the to of about 5 We from an already very peptide binder and generated a library by DNA and error-prone PCR. We applied directed evolution using ribosome display to the affinity a further result that ribosome display is for the of mutations and for the selection of binders very stringent even already from picomolar In to the of the ribosomal complex and the mRNA is not a of the of the results of the the results from directed evolution is that only was direct contact to the mutations were in the may the domain domain and the of the mutations in the clones were to on the of the scFv not direct contact to the antigen. likely these the library generation and do not to the improved After the selection for a containing all short range the of the binding was in a subtle This was exclusively achieved by the of in the second the flexibility of binding and the of rather than by we have the affinity a short to its very high affinity and the relatively small size of the antigen we the to be a for binding to a is We and Jermutus for and We for of the