Lutan Liu

G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN). We also conducted pH-dependent acoustic and densimetric characterizations of two DNA molecules that are compositionally identical to ODN but do not adopt the i-motif conformation, 5'-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5'-d(CACACTCCTCACCTCTCCACAC) (ODN2). Our results reveal that i-motif formation by ODN is not accompanied by changes in volume and compressibility. The volumetric similarity of the i-motif and coil states of ODN implies a fortuitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pH-dependent volumetric profiles of ODN, ODN1, and ODN2, along with the data on volumetric changes accompanying the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosines in the oligonucleotides causes release of the majority if not all of their counterions to the bulk. Thus, in the i-motif conformation, the oligomer no longer acts as a polyelectrolyte insofar as counterions are concerned. We discuss the biological ramifications of our results.

We characterized the conformational preferences of DNA in an equimolar mixture of complementary G-rich and C-rich strands from the promoter region of the c-MYC oncogene. Our CD-based approach presupposes that the CD spectrum of such a mixture is the spectral sum of the constituent duplex, G-quadruplex, i-motif, and coiled conformations. Spectra were acquired over a range of temperatures at different pHs and concentrations of KCl. Each spectrum was unmixed in terms of the predetermined spectra of the constituent conformational states to obtain the corresponding weighting factors for their fractional contributions to the total population of DNA. The temperature dependences of those contributions then were analyzed in concert according to a model based on a thermodynamic representation of the underlying equilibria. Fitted estimates of the melting enthalpy and temperature obtained for the duplex, G-quadruplex, and i-motif imply that the driving force behind dissociation of the duplex and the concomitant formation of tetrahelical structures is the folding of the G-strand into the G-quadruplex. The liberated C-strand adopts the i-motif conformation at acidic pH and exists in the coiled state at neutral pH. The i-motif alone cannot induce dissociation of the duplex even at pH 5.0, at which it is most stable. Under the physiological conditions of neutral pH, elevated potassium, and room temperature, the duplex and G-quadruplex conformations coexist with the C-strand in the coiled state. Taken together, our results suggest a novel, thermodynamically controlled mechanism for the regulation of gene expression.

Objective This study aims to compare the efficacy and safety of freehand atlantoaxial pedicle screws against custom 3D printed navigation template screws in the treatment of upper cervical fractures. Methods In our institution from 2010 to 2020, a retrospective cohort analysis of 23 patients with upper cervical fractures was done. These patients were separated into two groups: group A ( N = 12), which received customized 3D printed navigation template-assisted screws with virtual reality techniques, and group B ( N = 11), which received freehand screws assisted by intraoperative fluoroscopy. Every patient was monitored for more than 1 year. The two groups were contrasted in terms of screw implant accuracy, cervical spine Japanese Orthopaedic Association (JOA) score, American Spinal Injury Association (ASIA) score, visual analogue scale (VAS) score, surgical time, fluoroscopy times, and intraoperative blood loss. Results A total of 88 atlantoaxial pedicle screws in all, 46 in group A and 42 in group B, were implanted. In group A, the screw insertion accuracy rate was 95.7%, compared to 80.0% in group B ( P < 0.05). When compared to group B, group A had shorter surgery times, less blood loss, fewer fluoroscopies, a higher short-term JOA score, and overt pain reduction ( P < 0.05). However, there was no discernible difference between the two groups' VAS scores, long-term JOA scores, or ASIA scores (sensory and motor), at the most recent follow-up. Conclusion Individualized 3D printed guide leads to significant improvement in the screw safety, efficacy, and accuracy, which may be a promising strategy for the treatment of upper cervical fractures.

We employed a previously described procedure, based on circular dichroism (CD) spectroscopy, to quantify the distribution of conformational states adopted by equimolar mixtures of complementary G-rich and C-rich DNA strands from the promoter regions of the VEGF and Bcl-2 oncogenes. Spectra were recorded at different pHs, concentrations of KCl, and temperatures. The temperature dependences of the fractional populations of the duplex, G-quadruplex, i-motif, and coiled conformations of each promoter were then analyzed within the framework of a thermodynamic model to obtain the enthalpy and melting temperature of each folded-to-unfolded transition involved in the equilibrium. A comparison of the conformational data on the VEGF and Bcl-2 DNA with similar results on the c-MYC DNA, which we reported previously, reveals that the distribution of conformational states depends on the specific DNA sequence and is modulated by environmental factors. Under the physiological conditions of room temperature, neutral pH, and elevated concentrations of potassium ions, the duplex conformation coexists with the G-quadruplex conformation in proportions that depend on the sequence. This observed conformational diversity has biological implications, and it further supports our previously proposed thermodynamic hypothesis of gene regulation. In that hypothesis, a specific distribution of duplex and tetraplex conformations in a promoter region is fine-tuned to maintain the healthy level of gene expression. Any deviation from a healthy distribution of conformational states may result in pathology stemming from up- or downregulation of the gene.