Hong Xiao

Automated partial DNA sequencing was conducted on more than 600 randomly selected human brain complementary DNA (cDNA) clones to generate expressed sequence tags (ESTs). ESTs have applications in the discovery of new human genes, mapping of the human genome, and identification of coding regions in genomic sequences. Of the sequences generated, 337 represent new genes, including 48 with significant similarity to genes from other organisms, such as a yeast RNA polymerase II subunit; Drosophila kinesin, Notch, and Enhancer of split; and a murine tyrosine kinase receptor. Forty-six ESTs were mapped to chromosomes after amplification by the polymerase chain reaction. This fast approach to cDNA characterization will facilitate the tagging of most human genes in a few years at a fraction of the cost of complete genomic sequencing, provide new genetic markers, and serve as a resource in diverse biological research fields.

The polymorphic (TCAT)n repeat begins at base pair 1170 in intron 1 of the human tyrosine hydroxylase gene on chromosome I lpl5.5-pl5 (1). The polymorphism can be typed using the polymerase chain reaction (PCR) as described previously (2). The predicted length of the amplified sequence was 254 bp. Primer Sequences: CAGCTGCCCTAGTCAGCAC (TCAT strand); GCTTCCGAGTGCAGGTCACA (AGTA strand). Frequency: Estimated from 70 chromosomes of unrelated individuals. Heterozygosity index = 78%. PIC = 0.75. Allele (bp) Frequency KI 260 0.21 K2 256 0.26 K3 252 0.13 K4 248 0.14 KS 244 0.26 Mendelian Inheritance: Co-dominant segregation was observed in two informative families.

Journal Article Tetranucleotide repeat polymorphism at the human c-fes/fps proto-oncogene (FES) Get access Mihael H. Polymeropoulos, Mihael H. Polymeropoulos National Institute of Mental Health Neuroscience CenterSt. Elizabeths Hospital, Room 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar Denise S. Rath, Denise S. Rath National Institute of Mental Health Neuroscience CenterSt. Elizabeths Hospital, Room 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar Hong Xiao, Hong Xiao National Institute of Mental Health Neuroscience CenterSt. Elizabeths Hospital, Room 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar Carl R. Merril Carl R. Merril National Institute of Mental Health Neuroscience CenterSt. Elizabeths Hospital, Room 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar Nucleic Acids Research, Volume 19, Issue 14, 25 July 1991, Page 4018, https://doi.org/10.1093/nar/19.14.4018 Published: 25 July 1991

Journal Article Tetranucleotide repeat polymorphism at the human beta-actin related pseudogene H-beta-Ac-psi-2 (ACTBP2) Get access Mihael H. Polymeropoulos, Mihael H. Polymeropoulos National Institute of Mental Health Neuroscience Center, St Elizabeths HospitalRoom 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar Denise S. Rath, Denise S. Rath National Institute of Mental Health Neuroscience Center, St Elizabeths HospitalRoom 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar Hong Xiao, Hong Xiao National Institute of Mental Health Neuroscience Center, St Elizabeths HospitalRoom 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar Carl R. Merril Carl R. Merril National Institute of Mental Health Neuroscience Center, St Elizabeths HospitalRoom 131, 2700 Martin Luther King Avenue, Washington, DC 20032, USA Search for other works by this author on: Oxford Academic PubMed Google Scholar Nucleic Acids Research, Volume 20, Issue 6, 25 March 1992, Page 1432, https://doi.org/10.1093/nar/20.6.1432 Published: 25 March 1992