Shou‐Ih Hu

Structure-activity relationships of a lead hydroxamic acid inhibitor of recombinant human stromelysin were systematically defined by taking advantage of a concise synthesis that allowed diverse functionality to be explored at each position in a template. An ex vivo rat model and an in vivo rabbit model of stromelysin-induced cartilage degradation were used to further optimize these analogs for oral activity and duration of action. The culmination of these modifications resulted in CGS 27023A, a potent, orally active stromelysin inhibitor that blocks the erosion of cartilage matrix.

The human homologue of the Escherichia coli htrA gene product was identified by the differential display analysis of transcripts expressed in osteoarthritic cartilage. This transcript was identified previously as being repressed in SV40-transformed fibroblasts (Zumbrunn, J., and Trueb, B. (1996)FEBS Lett.398, 187–192). Levels of HtrA mRNA were elevated ∼7-fold in cartilage from individuals with osteoarthritis compared with nonarthritic controls. Differential expression of human HtrA protein was confirmed by an immunoblot analysis of cartilage extracts. Human HtrA protein expressed in heterologous systems was secreted and exhibited endoproteolytic activity, including autocatalytic cleavage. Conversion by mutagenesis of the putative active site serine 328 to alanine eliminated the enzymatic activity. Serine 328 was also found to be required for the formation of a stable complex with α1-antitrypsin. We have determined that the HtrA gene is highly conserved among mammalian species: the amino acid sequences encoded by HtrA cDNA clones from cow, rabbit, and guinea pig are 98% identical to human. In E. coli, a functionalhtrA gene product is required for cell survival after heat shock or oxidative stress; its role appears to be the degradation of denatured proteins. We propose that mammalian HtrA, with the addition of a new functionality during evolution, i.e. a mac25 homology domain, plays an important role in cell growth regulation. The human homologue of the Escherichia coli htrA gene product was identified by the differential display analysis of transcripts expressed in osteoarthritic cartilage. This transcript was identified previously as being repressed in SV40-transformed fibroblasts (Zumbrunn, J., and Trueb, B. (1996)FEBS Lett.398, 187–192). Levels of HtrA mRNA were elevated ∼7-fold in cartilage from individuals with osteoarthritis compared with nonarthritic controls. Differential expression of human HtrA protein was confirmed by an immunoblot analysis of cartilage extracts. Human HtrA protein expressed in heterologous systems was secreted and exhibited endoproteolytic activity, including autocatalytic cleavage. Conversion by mutagenesis of the putative active site serine 328 to alanine eliminated the enzymatic activity. Serine 328 was also found to be required for the formation of a stable complex with α1-antitrypsin. We have determined that the HtrA gene is highly conserved among mammalian species: the amino acid sequences encoded by HtrA cDNA clones from cow, rabbit, and guinea pig are 98% identical to human. In E. coli, a functionalhtrA gene product is required for cell survival after heat shock or oxidative stress; its role appears to be the degradation of denatured proteins. We propose that mammalian HtrA, with the addition of a new functionality during evolution, i.e. a mac25 homology domain, plays an important role in cell growth regulation. osteoarthritis base pairs polymerase chain reaction reverse transcription-PCR rapid amplification of cDNA ends insulin-like growth factor basic local alignment tool expressed sequence tag. Osteoarthritis (OA),1the most prevalent form of degenerative joint disease, involves chondrocyte loss and the breakdown of extracellular matrix components, leading to cartilage degeneration and the eventual deterioration of joint function (1Howell D.S. Moskowitz R.W. Howell D.S. Goldberg V.M. Mankin H.J. Osteoarthritis Diagnosis and Management. Sanders, Philadelphia1984: 129-146Google Scholar). From a therapeutic perspective, it is important to understand the molecular events triggering the onset of OA and the biochemical pathways responsible for the disease progression that appear to be influenced by a complexity of environmental and genetic factors (2Felson D.T. Rheum. Dis. Clin. N. Am. 1990; 16: 499-512PubMed Google Scholar, 3McAlindon T. Dieppe P. Br. J. Rheumatol. 1990; 29: 471-473Crossref PubMed Scopus (37) Google Scholar, 4Oddis C.V. Am. J. Med. 1996; 100: 10s-15sAbstract Full Text PDF PubMed Google Scholar). Chondrocytes, the exclusive cell type in cartilage, maintain the integrity of the collagen/proteoglycan network by responding to a variety of stresses, including the normal mechanical load as well as abnormal trauma and injury (5Muir H. Bioessays. 1995; 17: 1039-1048Crossref PubMed Scopus (347) Google Scholar). The cellular response to stress stimuli occurs through the regulation of a myriad of signal transduction pathways, leading to alterations in gene expression. Analysis of differential gene expression using various molecular biological techniques has been increasingly applied to investigate complex biological phenomena (6Wan J.S. Sharp S.J. Poirier G.M.-C. Wagaman P.C. Chambers J. Pyati J. Hom Y.-L. Galindo J.E. Huvar A. Peterson P.A. Jackson M.R. Erlander M.G. Nat. Biotechnol. 1996; 14: 1685-1691Crossref PubMed Scopus (132) Google Scholar). As an approach to study the molecular pathobiology of OA, we have used a mRNA differential display (7Liang P. Pardee A. Science. 1992; 257: 967-971Crossref PubMed Scopus (4707) Google Scholar) to screen for differences in gene expression between osteoarthritic and nonarthritic cartilage. A major advantage of this methodology is the capability to amplify minute amounts of transcripts and rapidly determine their nucleotide sequences. We have identified over 120 transcripts that appear to be differentially expressed in OA cartilage, only 29 of which correspond to known proteins. 2S-I. Hu and R. M. Crowl, unpublished observations. In this report, we describe the identification and characterization of one transcript (provisionally named ORF480) and its translation product, both of which are expressed at elevated levels in OA cartilage. The nucleotide sequence of ORF480 is identical to a recently described transformation-sensitive cDNA isolated from human fibroblasts (8Zumbrunn J. Trueb B. FEBS Lett. 1996; 398: 187-192Crossref PubMed Scopus (188) Google Scholar). ORF480 codes for a protein with distinct domains of homology to human mac25 (9Swisshelm K. Ryan K. Tsuchiya K. Sager R. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4472-4476Crossref PubMed Scopus (198) Google Scholar) and to a bacterial serine protease (HtrA) that is critical for the cellular response to thermal and oxidative stress (10Lipinska B. Sharma S. Georgopoulos C. Nucleic Acids Res. 1988; 16: 10053-10067Crossref PubMed Scopus (196) Google Scholar, 11Lipinska B. Zylicz M. Georgopoulos C. J. Bacteriol. 1990; 172: 1791-1797Crossref PubMed Google Scholar). This report provides the first evidence that the ORF480-encoded protein (human HtrA) exhibits autocatalytic cleavage as well as endoproteolytic activity against an exogenous substrate, β-casein. When incubated in the presence of serum, HtrA protein binds to and forms a stable complex with α1-antitrypsin. In addition, we have determined that the sequence of the HtrA-related domain of ORF480 is highly conserved among mammalian species. These findings open new avenues of investigation toward an understanding of the biological function(s) of mammalian HtrA. Total RNA from OA and nonarthritic human cartilage was isolated according to published methods (12Amin A.R. Attur M. Patel R.N. Thakker G.D. Marshall P.J. Rediske J. Stuchin S.A. Patel I.R. Abramson S.B. J. Clin. Invest. 1997; 99: 1231-1237Crossref PubMed Scopus (371) Google Scholar) and supplied to our laboratories by Drs. I. Patel and A. Amin (Hospital for Joint Diseases, New York University Medical School, New York, NY). Independent biochemical analyses of the isolated cartilage 3R. Goldberg, personal communication. as well as the differential mRNA expression of type II and type III collagens (see “Results”) were consistent with the indicated pathological state of the samples used in this study. First-strand cDNA was synthesized from 0.2 μg of total RNA with each of the three anchored oligodeoxythymidylic acid primers from GenHunter Corp. The reaction (20 μl) was carried out at 37 °C for 60 min. For PCR amplification, 1 μl of the cDNA served as the template in a 10-μl reaction mix containing 10 mm Tris-HCl (pH 8.4), 1.5 mm MgCl2, 50 mm KCl, 0.001% gelatin, 2 μmdeoxynucleotide triphosphates, 0.2 μm 5′ arbitrary primer (AP-49 or AP-58 from the RNA image kits obtained from GenHunter Corp.), 2 μm of the same anchored primer used in the cDNA synthesis, 5 μCi of [α-33P]dATP (2000 Ci/mmol; DuPont New England Nuclear), and 2.5 units of AmpliTaq DNA polymerase (Perkin-Elmer). Samples were subjected to 40 cycles of amplification under the following conditions: denaturing at 94 °C for 30 s, annealing at 40 °C for 2 min, extension at 72 °C for 30 s, and a final extension at 72 °C for 5 min. The resulting PCR products were resolved on a denaturing polyacrylamide gel and visualized by autoradiography of the dried gel. PCR products of interest were excised from the gel, and the DNA was eluted and reamplified by PCR using the same primers and conditions described above, excluding the labeled nucleotide. PCR products were resolved on a 1.5% agarose gel, excised, and ligated into cloning vector PCR II 2.1 (TA cloning kit; Invitrogen). Clones of the PCR-generated fragments were obtained by transformation of Escherichia coli strain DH5α (Life Technologies, Inc.). DNA sequences were determined for at least three independent clones of each fragment using Dye Terminator Cycle Sequencing on an ABI PRISM 377 DNA sequencing system (Perkin-Elmer). First-strand cDNA was synthesized from total RNA isolated from OA and nonarthritic cartilage. 200 ng of total RNA and 10 pmol of primer T30VN (where V = A, C, and G and N = A, C, G, and T) were mixed in a 6-μl volume, heated to 72 °C for 3 min, and quenched on ice for 3 min. Reverse transcription reactions (10 μl) were prepared with final concentrations of 50 mm Tris-HCl (pH 8.3), 6 mmMgCl2, 75 mm KCl, 1 mmdeoxynucleotide triphosphates, and 10 units of Moloney murine leukemia virus reverse transcriptase. This mixture was incubated at 42 °C for 1.5 h and at 94 °C for 5 min and quenched on ice. Serial dilutions of cDNA from different individuals were used for PCR amplification with a primer set for actin (forward primer, GGAGTCCTGTGGCATCCACGAAACTAC; reverse primer, CACATCTGCTGGAAGGTGGACAGCG) in a 25-μl reaction volume with 10 mm Tris-HCl (pH 8.3), 50 mm KCl, 1.5 mm MgCl2, 0.001% gelatin, 20 μm deoxynucleotide triphosphates, and 1.25 units of AmpliTaq PCR was for cycles °C for 30 s, °C for 30 s, 72 °C for 2 min, and a final at 72 °C for μl of the reaction mix were on a polyacrylamide gel, with and using and were to that the reaction was the of These conditions were used for PCR reactions to the levels of expression for type II and type III Levels of expression were to the levels of actin for each A reaction with template was carried out for each primer set to the of cDNA were carried out with ng of total RNA isolated from OA cartilage were for the of cDNA with ligated at both ends according to the cDNA system primer from the sequence of clones and an primer were used for 5′ The reaction mix mm mm 75 0.2 mm deoxynucleotide triphosphates, and DNA polymerase mix The reaction and were as 94 °C for 5 cycles of 94 °C for 30 and 72 °C for 2 cycles of 94 °C for 30 and °C for 2 cycles of 94 °C for 30 and °C for 2 min, and a final at 72 °C for min. products were on a agarose gel. DNA fragments between and between were isolated from the gel and using the cloning were by PCR with The clones with the were identified by PCR using and DNA from clones was prepared and as described The cDNA for ORF480 was by PCR using cDNA from RNA (human as the PCR primers and to the 5′ and ends of the of were PCR was with polymerase for cycles °C for 1 min, °C for 1 min, and 72 °C for 3 to the a 5′ of the PCR with this of primers a cDNA fragment with an of the The sequence of the DNA fragment of the site was primers and were used to a DNA fragment 5′ of the PCR conditions were to which the of the The resulting DNA fragments were at the site and into of The final cDNA fragment of ORF480 to of human cartilage was with μl of 50 mm Tris-HCl containing and a mixture of protease at Samples containing 50 μg of total protein were prepared for gel and immunoblot analysis with using the system was against the human HtrA domain expressed in E. Hu and J. unpublished observations. This to The was using the mutagenesis in primer extension with polymerase through the 5′ of the site of ORF480 we a DNA fragment to amino acid to the of the into and used it as a used for the mutagenesis reaction were and by sequence analysis that the been the ORF480 was into The resulting was The translation product of ORF480 was synthesized in using and as in the The reaction products were on a gel. the of the the gel was dried under a at °C and on a Human were in (Life Technologies, with (Life Technologies, and (Life Technologies, at 37 °C in a were with the expression vector using the Clones were by with (Life Technologies, at a of and incubated in for expression of were as at °C in the ORF480 cDNA were the and the (Life Technologies, Inc.). conditions were determined by the of and of the secreted ORF480 protein in both heterologous systems was confirmed by the immunoblot analysis of using as described For immunoblot analyses to the presence of molecular of HtrA protein we used that been of by unpublished observations. the protease activity of ORF480-encoded 75 μl of were incubated with 50 μg of in 50 mm Tris-HCl (pH for 1 h at 37 and the reaction products were by gel using or A DNA from various was for 30 min at °C and with a HtrA-related fragment of ORF480 in rapid at °C for min. The was with for 20 min at for 10 min at °C and with at °C for 10 min. The were visualized using a HtrA was isolated from a cDNA by using the human cDNA as a HtrA cDNA fragments were isolated by PCR from and guinea pig cDNA using primers from the human sequence to of amino acid sequence coli The DNA sequences of the clones were determined as described PCR primers were and used for 5′ and to cDNA In the of for differences in gene expression between osteoarthritic and nonarthritic cartilage by mRNA differential PCR and were identified using different arbitrary primers analysis of and that the PCR products correspond to the of the same mRNA the 5′ PubMed Scopus Google a PCR fragment to was isolated and from OA The DNA sequences of independent clones from products and open of and 328 was in the 5′ sequences of clones and and indicated a mRNA of over 2 it was that cDNA clones the this in the a J. 1990; PubMed Scopus Google Scholar) of the and identified sequences and a cDNA The sequence of an open of amino The DNA sequence of was identical to of for a PCR-generated the cDNA clones isolated from OA cartilage and the sequence from the same gene analysis indicated that the mRNA for ORF480 is expressed in human and in normal human fibroblasts PCR-generated fragments to the ORF480 were isolated from cDNA from RNA (see The DNA sequence of the ORF480 cDNA was determined to be identical to that of alignment of the cDNA clones described in this report in to identified from the is in in are the protein domains ORF480 as described of ORF480 cDNA clones and protein which is as a is a cDNA containing a open differential display PCR products and sequences and and cDNA clones from human cartilage and and normal fibroblasts are as to The mac25 and HtrA homology domains ORF480 are indicated as open by the signal sequence The the mac25 domain and the sequence the HtrA domain are as open the of the described and Trueb (8Zumbrunn J. Trueb B. FEBS Lett. 1996; 398: 187-192Crossref PubMed Scopus (188) Google Scholar) the of the same cDNA from human the expression of the mRNA was repressed in SV40-transformed analysis of the sequence encoded by the cDNA a putative signal sequence an protein 3 homology domain a and the major domain of homology coli HtrA In addition, a of containing the domains Sci. 1997; PubMed Scopus Google Scholar) bacterial HtrA as well as the human HtrA The of the domain ORF480 is indicated in analysis of the ORF480 in from that of and Trueb to differences in methods and the of the to the protein sequence we found human a of the protein (9Swisshelm K. Ryan K. Tsuchiya K. Sager R. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4472-4476Crossref PubMed Scopus (198) Google to have the of homology to the domain of ORF480 For for the mac25 alignment with ORF480 is compared = for growth protein the sequence of mac25 the to ORF480 a conserved serine protease as out by H. T. S. M. 1996; Google mac25 is to to growth and we that the sequence of also the the differential display and the in the mRNA levels of human HtrA in OA cartilage compared with nonarthritic cartilage, primer pairs for a of ORF480 cDNA were used for The of this using expression levels of and for that HtrA mRNA is at levels that are ∼7-fold in OA cartilage in nonarthritic controls. in A are for both type II and type III which were also identified in our differential display that that levels of transcripts are elevated in the samples used in a that is consistent with of in OA cartilage T. H. K. J. Clin. PubMed Scopus Google Scholar). the differential expression of human HtrA protein in OA cartilage, of OA and cartilage samples were by immunoblot analysis using an prepared against the HtrA domain expressed in E. coli These a in the levels of HtrA protein in OA nonarthritic cartilage that are consistent with the analysis of the mRNA A cDNA containing the of ORF480 was into expression vector (see and This the expression of the protein in an in system 5 A, 1 molecular products were also in the gel a that was to that for E. coli HtrA B. Zylicz M. Georgopoulos C. J. Bacteriol. 1990; 172: 1791-1797Crossref PubMed Google Scholar, J. A. K. K. B. 1995; PubMed Scopus Google Scholar). the conserved active site serine 328 in ORF480 to alanine by mutagenesis in the of the molecular 5 A, 3 and This which was previously for E. coli HtrA J. A. K. K. B. 1995; PubMed Scopus Google that the translation product of the human HtrA is a serine protease with autocatalytic activity. When ORF480 is expressed in the translation product is by immunoblot analysis using in the by h A distinct set of molecular is by immunoblot analysis in samples at and h 5 which is consistent with the autocatalytic activity of the ORF480-encoded protein (HtrA) in the expression system described As a molecular protein is by immunoblot analysis in the samples at and h of the ORF480-encoded protein (HtrA) with in the of cleavage products of this 5 the expression of ORF480 in mammalian of were with resulting in the and of the HtrA protein as determined by immunoblot analysis 5 C, The from different isolated clones from the activity against 5 C, resulting in at least distinct fragments of the substrate, which is to the in the using HtrA in B. The of activity in the samples from each 5 C, with the of HtrA protein in the immunoblot 5 C, The of ORF480 (HtrA) expressed in activity against 5 and In ORF480 protein (HtrA) expressed in both and in molecular were with in acid sequence analysis of the protein isolated from this indicated a of HtrA sequence and the sequence of the form of from expression that the stable complex in incubated in the presence of was in conditions In addition to the indicated protein the an appears after h of which is a degradation product of the The addition of to incubated in in the formation of the molecular with the same as in with The formation of the stable complex the active site serine 328 in HtrA is to alanine In of to study the regulation of ORF480 (HtrA) in of OA, we to determine the human cDNA be used as a to screen for cDNA clones from mammalian species. A a analysis in which total DNA isolated from various mammalian and one was human cDNA under (see The which to a of DNA that the gene sequence for the HtrA-related domain of ORF480 is conserved among species. This was confirmed by analysis of the nucleotide sequences of ORF480 cDNA clones isolated from cow, guinea and rabbit, which are and identical to the human and the amino acid sequences from the cDNA sequences of the three mammalian are 98% identical to the human sequence As of an to alterations in gene expression in osteoarthritic cartilage, we identified and a to in this report as and its translation The that the levels of ORF480 mRNA and protein are elevated in osteoarthritic cartilage. ORF480 a protein with distinct domains of The domain of ORF480 is to a recently gene product to growth protein (9Swisshelm K. Ryan K. Tsuchiya K. Sager R. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4472-4476Crossref PubMed Scopus (198) Google Scholar) and H. T. S. M. 1996; Google Scholar). The domain, the of the ORF480 amino acid is identical to bacterial HtrA serine The evidence the in activity of the ORF480-encoded which we is the human homologue of bacterial HtrA. In HtrA is a critical of the cellular response to which is by the of a set of heat shock PubMed Scopus Google Scholar). In addition to heat shock are by oxidative stress R.W. Full Text PDF PubMed Scopus Google H. H. R. Georgopoulos PubMed Scopus Google and expression of S.A. Goldberg Full Text PDF PubMed Scopus Google Scholar). A htrA gene is for the bacterial cell to heat shock B. Zylicz M. Georgopoulos C. J. Bacteriol. 1990; 172: 1791-1797Crossref PubMed Google Scholar). HtrA is identical to K. K. J. J. Bacteriol. PubMed Scopus Google a serine named as one of from E. coli Scopus Google Scholar). of the active site serine to alanine in HtrA in a loss of protease activity in and a loss of as determined by the to the B. Zylicz M. Georgopoulos C. J. Bacteriol. 1990; 172: 1791-1797Crossref PubMed Google Scholar). B. Zylicz M. Georgopoulos C. J. Bacteriol. 1990; 172: 1791-1797Crossref PubMed Google Scholar) that the role of HtrA is cleavage of denatured in the evidence this has been recently by E. J. A. 1996; PubMed Scopus Google Scholar, H. J. Bacteriol. 1996; PubMed Google Scholar). on the of the HtrA sequence as in this report the DNA in and at the amino acid in HtrA function also be of its biological role of for the human serine protease encoded by ORF480 be an important of of interest extracellular matrix growth and that growth The autocatalytic cleavage of human HtrA protein that we in a of regulation in at least one form of HtrA is by immunoblot analysis in OA cartilage. The that binds to and forms a stable complex with HtrA that this serine protease a role in its regulation in As one the activity of human HtrA is by personal communication. Levels of various protease including are known to be in osteoarthritic cartilage R.W. P. Rheum. Scopus Google Scholar). evidence be required to the of human HtrA expression and are The of of mammalian HtrA and the addition of a new domain during evolution, a biological role for the ORF480-encoded protein (HtrA) that of denatured proteins. mac25 was described as a of the protein (9Swisshelm K. Ryan K. Tsuchiya K. Sager R. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4472-4476Crossref PubMed Scopus (198) Google H. T. S. M. 1996; Google Scholar) that mac25 is to an that its expression in in growth A was during the of clones of human with ORF480 and unpublished observations. is that human HtrA is in cell growth a of growth factor systems the system 1997; PubMed Scopus Google Scholar). The in ORF480-encoded which is conserved in a of serine protease also occurs and and appear to function as extracellular that to and the activity of growth factors K. 16: Full Text PDF PubMed Scopus Google Scholar). has been to serine of the the Res. PubMed Scopus Google Scholar). The presence of the protease in ORF480 that the human HtrA serine protease be a the that it serine be The the in of human HtrA, with from the of the various to which it is to the role of mammalian HtrA. We R. and J. for on the of this J. for against human HtrA, R. Goldberg for the biochemical analyses of the cartilage used in this and for the amino acid sequence

Osteopontin and PP(i) both suppress hydroxyapatite deposition. Extracellular PP(i) deficiency causes spontaneous hypercalcification, yet unchallenged osteopontin knockout mice have only subtle mineralization abnormalities. We report that extracellular PP(i) deficiency promotes osteopontin deficiency and correction of osteopontin deficiency prevents hypercalcification, suggesting synergistic inhibition of hydroxyapatite deposition. Nucleotide pyrophosphatase phosphodiesterase (NPP) isozymes including PC-1 (NPP1) function partly to generate PP(i), a physiologic calcification inhibitor. PP(i) transport is modulated by the membrane channel protein ANK. Spontaneous articular cartilage calcification, increased vertebral cortical bone formation, and peripheral joint and intervertebral ossific ankylosis are associated with both PC-1 deficiency and expression of truncated ANK in ank/ank mice. To assess how PC-1, ANK, and PP(i) regulate both calcification and cell differentiation, we studied cultured PC-1 -/- and ank/ank mouse calvarial osteoblasts. PC-1 -/- osteoblasts demonstrated approximately 50% depressed NPP activity and markedly lowered extracellular PP(i) associated with hypercalcification. These abnormalities were rescued by transfection of PC-1 but not of the NPP isozyme B10/NPP3. PC-1 -/- and ank/ank cultured osteoblasts demonstrated not only comparable extracellular PP(i) depression and hypercalcification but also marked reduction in expression of osteopontin (OPN), another direct calcification inhibitor. Soluble PC-1 (which corrected extracellular PP(i) and OPN), and OPN itself (> or = 15 pg/ml), corrected hypercalcification by PC-1 -/- and ank/ank osteoblasts. Thus, linked regulatory effects on extracellular PP(i) and OPN expression mediate the ability of PC-1 and ANK to regulate calcification.

OBJECTIVE: Aging and osteoarthritic (OA) cartilage commonly demonstrate enhanced expression of the large, transforming growth factor beta (TGFbeta)-inducible glycoprotein cartilage intermediate-layer protein (CILP) as well as enhanced extracellular inorganic pyrophosphate (PPi) that promotes the deposition of calcium pyrophosphate dihydrate crystals. In normal chondrocytes, TGFbeta induces elevated chondrocyte extracellular PPi. Insulin-like growth factor 1 (IGF-1) normally blocks this response and reduces extracellular PPi. However, chondrocyte resistance to IGF-1 is observed in OA and aging. Because CILP was reported to chromatographically fractionate with PPi-generating nucleotide pyrophosphatase phosphodiesterase (NPP) activity, it has been broadly assumed that CILP itself has NPP activity. Our objective was to directly define CILP functions and their relationship to IGF-1 in chondrocytes. METHODS: Using primary cultures of articular chondrocytes from the knee, we defined the function of the previously described CILP (CILP-1) and of a recently described 50.6% identical protein that we designated the CILP-2 isoform. RESULTS: Both CILP isoforms were constitutively expressed by primary cultured articular chondrocytes, but only CILP-1 expression was detectable in cultured knee meniscal cartilage cells. Neither CILP isoform had intrinsic NPP activity. But CILP-1 blocked the ability of IGF-1 to decrease extracellular PPi, an activity specific for the CILP-1 N-terminal domain. The CILP-1 N-terminal domain also suppressed IGF-1-induced (but not TGFbeta-induced) proliferation and sulfated proteoglycan synthesis, and it inhibited ligand-induced IGF-1 receptor autophosphorylation. CONCLUSION: Two CILP isoforms are differentially expressed by chondrocytes. Neither CILP isoform exhibits PPi-generating NPP activity. But, increased expression of CILP-1, via N-terminal domain-mediated inhibitory effects of CILP-1 on chondrocyte IGF-1 responsiveness, could impair chondrocyte growth and matrix repair and indirectly promote PPi supersaturation in aging and OA cartilage.

OBJECTIVE: To determine whether matrix metalloproteinases (MMPs) degrade cartilage oligomeric matrix protein (COMP) to produce fragments similar to those found in synovial fluid (SF) from patients with arthritis. METHODS: COMP fragments were generated in vitro by treating (a) bovine articular cartilage with interleukin-1alpha (IL-1alpha), (b) purified bovine COMP with MMPs, and (c) articular cartilage with MMPs. The fragments generated in each case were analyzed by Western blot, using an antibody to the C-terminal heptadecapeptide of COMP. RESULTS: IL-1alpha stimulation of cartilage resulted in a fragmentation of COMP, which was inhibited by MMP inhibitors CGS 27023A and BB-94. Isolated, recombinant MMPs rapidly degraded purified COMP, as well as COMP residing in cartilage. Several COMP fragments produced in vitro had similar electrophoretic mobility to those in SF of patients with arthritis. CONCLUSION: MMPs may contribute to the COMP fragments found in vivo. Quantitation of MMP-specific fragments may be useful in the evaluation of MMP inhibitors in patients with arthritis.