Rainer Waldmann

We have cloned and expressed a novel proton-gated Na+ channel subunit that is specific for sensory neurons. In COS cells, it forms a Na+ channel that responds to a drop of the extracellular pH with both a rapidly inactivating and a sustained Na+ current. This biphasic kinetic closely resembles that of the H+-gated current described in sensory neurons of dorsal root ganglia (1). Both the abundance of this novel H+-gated Na+ channel subunit in sensory neurons and the kinetics of the channel suggest that it is part of the channel complex responsible for the sustained H+-activated cation current in sensory neurons that is thought to be important for the prolonged perception of pain that accompanies tissue acidosis (1, 2). We have cloned and expressed a novel proton-gated Na+ channel subunit that is specific for sensory neurons. In COS cells, it forms a Na+ channel that responds to a drop of the extracellular pH with both a rapidly inactivating and a sustained Na+ current. This biphasic kinetic closely resembles that of the H+-gated current described in sensory neurons of dorsal root ganglia (1). Both the abundance of this novel H+-gated Na+ channel subunit in sensory neurons and the kinetics of the channel suggest that it is part of the channel complex responsible for the sustained H+-activated cation current in sensory neurons that is thought to be important for the prolonged perception of pain that accompanies tissue acidosis (1, 2). Many painful inflammatory and ischemic conditions are accompanied by a decrease of the extracellular pH (2Steen K.H. Reeh P.W. Anton F. Handwerker H.O. J. Neurosci. 1992; 12: 86-95Crossref PubMed Google Scholar, 3Rang H.P. Bevan S. Dray A. Br. Med. Bull. 1991; 47: 534-548Crossref PubMed Scopus (228) Google Scholar). H+-gated cation channels are present in sensory neurons (1Bevan S. Yeats J. J. Physiol. ( Lond .). 1991; 433: 145-161Crossref PubMed Scopus (301) Google Scholar, 4Krishtal O.A. Pidoplichko V.I. Neuroscience. 1981; 6: 2599-2601Crossref PubMed Scopus (154) Google Scholar, 5Konnerth A. Lux H.D. Morad M. J. Physiol. ( Lond .). 1987; 386: 603-633Crossref PubMed Scopus (155) Google Scholar, 6Akaike N. Ueno S. Prog. Neurobiol. 1994; 43: 73-83Crossref PubMed Scopus (50) Google Scholar), and it is likely that those acid-sensing ion channels are the link between tissue acidosis and pain. We recently cloned a rapidly inactivating H+-gated cation channel ASIC 1The abbreviations used are: ASIC,acid-sensing ionchannel; DRASIC, dorsal root ganglia acid sensing ionchannel; PCR, polymerase chain reaction; DRG, dorsal root ganglia; MES, 4-morpholineethanesulfonic acid; DIG, digoxigenin. (7Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1148) Google Scholar) (acid-sensing ionchannel). Fast inactivating H+-gated cation currents were described in neurons of the central nervous system (6Akaike N. Ueno S. Prog. Neurobiol. 1994; 43: 73-83Crossref PubMed Scopus (50) Google Scholar, 8Grantyn R. Perouansky M. Rodriguez-Tebar A. Lux H.D. Dev. Brain Res. 1989; 49: 150-155Crossref PubMed Scopus (29) Google Scholar,9Ueno S. Nakaye T. Akaike N. J. Physiol. ( Lond .). 1992; 447: 309-327Crossref PubMed Scopus (50) Google Scholar) and in sensory neurons (4Krishtal O.A. Pidoplichko V.I. Neuroscience. 1981; 6: 2599-2601Crossref PubMed Scopus (154) Google Scholar, 5Konnerth A. Lux H.D. Morad M. J. Physiol. ( Lond .). 1987; 386: 603-633Crossref PubMed Scopus (155) Google Scholar, 6Akaike N. Ueno S. Prog. Neurobiol. 1994; 43: 73-83Crossref PubMed Scopus (50) Google Scholar), tissues where ASIC is well expressed (7Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1148) Google Scholar). However, rapidly inactivating H+-gated cation channels cannot account solely for the prolonged sensation of pain that accompanies tissue acidosis. Sensory neurons respond to a drop in pH with a rapidly inactivating followed by a sustained current, which is thought to mediate the non-adaptive pain caused by acids (1Bevan S. Yeats J. J. Physiol. ( Lond .). 1991; 433: 145-161Crossref PubMed Scopus (301) Google Scholar). Here we describe the cloning of a H+-gated cation channel specific for sensory neurons that has both a rapidly inactivating and a sustained component. We used an anchored PCR approach to identify the sequences upstream and downstream of the expressed sequence tag (W62694). An double stranded adapter (anchor) was prepared by annealing the oligonucleotides GATTTAGGTGACACTATAGAATCGAGGTCGACGGTATCCAGTCGACGAATTC and PO4-GAATTCGTCGACTG-NH2. The shorter oligonucleotide was protected with a 3′ NH2 group to avoid extension during the PCR reaction. This adapter was ligated to double stranded rat brain cDNA resulting in a cDNA with known sequences (the anchor) on both extremities. The so prepared anchored cDNA was used to amplify the 5′ and the 3′ end of the coding sequence by PCR. This was done using either the primer GATTTAGGTGACACTATAGAA or TAGAATCGAGGTCGACGGTATC, which are identical to parts of the longer of the two adapter oligonucleotides together with either the sense primer (CACTACACGCTATGCCAAGG, for amplification of the 3′ end) or the antisense primer (CCCAGCAACTCCGACACTTC, for amplification of the 5′ end) complementary to the expressed sequence tag (W62694). The PCR products were subcloned into Bluescript, and five clones each for the 5′ PCR and for the 3′ PCR were sequenced. The anchored PCR allowed us to identify the sequences upstream of the first ATG codon and downstream of the stop codon. However all clones isolated from brain contained introns with in frame stop codons and code for truncated proteins lacking the second transmembrane domain that was found to be essential for channel function (10Waldmann R. Champigny G. Lazdunski M. J. Biol. Chem. 1995; 270: 11735-11737Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). Analysis of the tissue distribution showed that high levels of the mRNA are only found in DRG. Primers flanking the coding sequence (sense: ACGAATTCTCCCTGGTCCAGCCATGAAAC, antisense: CCTCGAGCTAGAGCCTTGTGACGAGGTAA) that contained an EcoRI site (sense) or an XhoI site (antisense) were used to amplify the full-length coding sequence from DRG cDNA. The PCR product was digested with EcoRI and XhoI and subcloned into the EcoRI/SalI-digested PCI expression vector. One clone was sequenced on both strands, and two independent clones were sequenced on one strand using an Applied Biosystems sequencer. Unlike in brain, the three clones isolated from DRG code for full-length proteins. COS7 cells were co-transfected with DRASIC cDNA in the PCI expression vector and an expression vector containing the CD8 receptor cDNA using DEAE-dextran. 3 days later, cells binding CD8 antibody-coated beads (11Jurman M.E. Boland L.M. Yellen G. BioTechniques. 1994; 17: 876-881PubMed Google Scholar) were used for experiments. Ion currents were recorded using either the whole cell or the patch-clamp technique. The pipette solution contained (in mm): KCl 120, NaCl 30, MgCl2 2, EGTA 5, HEPES 10 (pH 7.2). For the “0 sodium” solution NaCl was replaced by KCl. The bath solution contained in mm: NaCl 140, KCl 5, MgCl2 2, CaCl22, HEPES 10 (pH 7.3). Rapid changes in extracellular pH were induced by opening an outlet of a microperfusion system at a distance of ∼50 μm from the cell. Test solutions having a pH of less then 6 were buffered with 10 mm MES rather than HEPES. Experiments were carried out at room temperature (20–24 °C). 4 μg of total RNA from dorsal root ganglia of 7-day-old rats and 4 μg of poly(A+) RNA from adult rat brain were separated on a 1% formaldehyde-agarose gel and subsequently transferred to nylon membranes. The blots were hybridized with a random prime32P-labeled fragment of the DRASIC cDNA corresponding to nucleotide 141–1145 in 6 × SSC, 10 × Denhardt's solution, 0.1% SDS, 100 μg/ml herring sperm DNA, washed with 0.1 × SSC, 0.1% SDS at 70 °C, and subsequently exposed to a Fuji phosphoimager screen. For the in situ hybridizations on frozen fixed 10-μm brain sections from adult Wistar rats, we used a33P-random prime-labeled fragment of DRASIC corresponding to nucleotide 141–1145. Brain sections from adult rats were hybridized with the 33P-end-labeled probes overnight at 37 °C in 50% formamide, 2 × SSC, and subsequently washed at room temperature in 1 × SSC. Sections (6 μm) and primary cultures of rat dorsal root ganglia were hybridized with double-stranded DNA fragments labeled by PCR with DIG-dUTP (sections), or fluorescein-12-dUTP (primary cultures). The probes used correspond to nucleotide 141–1145. Probe labeling, sample preparation, hybridization, and visualization of DIG nucleic acids with alkaline phosphatase-conjugated anti-DIG antibodies was carried out following the protocols from Boehringer Mannheim. Primary cultures of DRG neurons from 4-day-old rats were prepared essentially as described (1Bevan S. Yeats J. J. Physiol. ( Lond .). 1991; 433: 145-161Crossref PubMed Scopus (301) Google Scholar) and used for in situ hybridization after 7 days in culture. Thein situ hybridization results shown were confirmed with one additional probe. Sequence positions given refer to the sequence submitted to GenBank™. The sequence alignment was computed with the GCG (Genetics Computer Group, Madison, WI) software package. All comparisons of sequences with data bases were done using the Blast network server at the National Center for Biotechnology Information (NCBI). Comparison of the ASIC protein sequence with the data base of expressed sequence tags identified one novel member of this family of ion channels. We used anchored PCR to clone the complete coding sequence from rat DRG. The DRASIC cDNA has an open reading frame of 1599 base pairs preceded by stop codons and codes for a protein of 533 amino acids. DRASIC belongs to the amiloride-sensitive Na+channel (12Canessa C.M. Horisberger J.D. Rossier B.C. Nature. 1993; 361: 467-470Crossref PubMed Scopus (827) Google Scholar, 13Canessa C. Schild L. Buell G. Thorens B. Gautschi I. Horisberger J.D. Rossier B.C. Nature. 1994; 367: 463-467Crossref PubMed Scopus (1775) Google Scholar, 14Lingueglia E. Voilley N. Waldmann R. Lazdunski M. Barbry P. FEBS Lett. 1993; 318: 95-99Crossref PubMed Scopus (317) Google Scholar, 15Lingueglia E. Renard S. Waldmann R. Voilley N. Champigny G. Plass H. Lazdunski M. Barbry P. J. Biol. Chem. 1994; 269: 13736-13739Abstract Full Text PDF PubMed Google Scholar, 16Waldmann R. Champigny G. Bassilana F. Voilley N. Lazdunski M. J. Biol. Chem. 1995; 270: 27411-27414Abstract Full Text Full Text PDF PubMed Scopus (252) Google Scholar, 17Voilley N. Lingueglia E. Champigny G. Mattei M.G. Waldmann R. Lazdunski M. Barbry P. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 247-251Crossref PubMed Scopus (213) Google Scholar, 18Voilley N. Bassilana F. Mignon C. Merscher S. Mattei M.G. Carle G.F. Lazdunski M. Barbry P. Genomics. 1995; 28: 560-565Crossref PubMed Scopus (88) Google Scholar)/degenerin (19Huang M. Chalfie M. Nature. 1994; 367: 467-470Crossref PubMed Scopus (345) Google Scholar, 20Chalfie M. Wolinsky E. Nature. 1990; 345: 410-416Crossref PubMed Scopus (259) Google Scholar, 21Waldmann R. Champigny G. Voilley N. Lauritzen I. Lazdunski M. J. Biol. Chem. 1996; 271: 10433-10434Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar) family of ion channels and shares 53% sequence identity with its closest relative ASIC (Fig. 1). A DRASIC transcript of ≈2.6 kilobases was detected in total RNA of DRG (Fig. 2 a). In brain poly(A+) RNA where ASIC mRNA is abundant (7Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1148) Google Scholar), no DRASIC transcript was detectable. Furthermore a mouse multitissue Northern blot (CLONTECH) with poly(A+) RNA from brain, heart, spleen, lung, liver, skeletal muscle kidney, and testis did not give any signal (not shown) with the probe that labeled the DRASIC mRNA in total RNA from DRG, indicating that DRASIC is specific for sensory neurons. In situ hybridization confirmed those results (Fig. 2, b–d). DRASIC is expressed in DRG neurons and absent in brain. The small sensory neurons are thought to carry the nociceptive signals from polymodal sensory nerve endings and interestingly small neurons are intensely labeled. The specific expression in sensory neurons suggests that the DRASIC channel has properties required for a specific function of this type of neuron. Expression of DRASIC in COS cells induced a H+-gated cation channel with properties clearly distinct from those of ASIC (7Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1148) Google Scholar). A rapid decrease of the extracellular pH from pH 7.4 to pH 4 induces a fast rising, rapidly inactivating current followed by a much slower activating sustained inward current (Fig. 3 a). Surprisingly, expression of DRASIC can induce both a rapidly and a slowly activating current. The kinetics of the DRASIC current very closely resemble the biphasic H+-gated cation current described in sensory neurons (1Bevan S. Yeats J. J. Physiol. ( Lond .). 1991; 433: 145-161Crossref PubMed Scopus (301) Google Scholar). Both the transient and the sustained DRASIC current reverse at +32 ± 3 mV (n = 5), which is close to the Na+equilibrium potential of +40 mV in the experimental conditions concerned (Fig. 3 b). This indicates that the two components are highly selective for Na+(gNa+/gK+ = 13.5). Unitary currents were recorded from outside-out patches in the absence of Na+ in the pipette (Fig. 3, c and d). The slope conductance of DRASIC is with 12.6 ± 0.2 picosiemens (n = 3) (Fig. 3 d), close to that reported for ASIC (14.3 picosiemens) (7Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1148) Google Scholar). The unitary current has a reversal potential of +62 mV (Fig. 3 d), indicating an 11.5-fold higher selectivity of the channel for Na+ over K+. Amiloride inhibits the transient current with aK0.5 of 63 ± 2 μm (Fig. 3,e and f). The effect of amiloride on the sustained DRASIC current is complex. In the presence of 200 μm amiloride where the transient current is inhibited by 68 ± 5% (Fig. 3, e and f), the sustained current is higher than in the absence of amiloride (Fig. 3 e). A closer examination of the pH dependence of the DRASIC current shows that the transient and the sustained phase can be clearly separated (Fig. 3, g–i). The transient current is activated when the pH drops only slightly (half-maximal activation at pH 6.5 when stepping from pH 7.3; Fig. 3 h) but requires an initial pH above 7 for full activation (Fig. 3 i). On the contrary, the sustained current needs more important acidification (below pH 4) for activity (Fig. 3 h) but may still be activated if the resting pH is far below pH 7 (Fig. 3 i). The situation is similar in sensory neurons (1Bevan S. Yeats J. J. Physiol. ( Lond .). 1991; 433: 145-161Crossref PubMed Scopus (301) Google Scholar) where a slight acidification activates only the transient current, while both the transient and the sustained current are activated after more important drops of the extracellular pH. A H+-gated cation channel capable of mediating a prolonged sensation of pain during tissue acidosis should not only be activated when the pH drops rapidly but also when the pH decreases slowly, since this is likely to happen during the onset of a tissue acidosis. Unlike ASIC, that requires a rapid (≪1 s) drop of the pH (not shown), DRASIC responds to slow decreases of the pH (Fig. 3 j). If the extracellular pH is decreased gradually by approaching the cell slowly with the perfusion outlet, the first transient current disappears, while the sustained component still develops to its full size (Fig. 3 j). The kinetics of the DRASIC channel and the fact that DRASIC mRNA is only present in sensory neurons, where it is abundant, suggest that DRASIC is part of the channel complex responsible for the sustained H+-gated current in sensory neurons. However, there are important differences between the non-inactivating DRASIC current and the sustained current described in sensory neurons (1Bevan S. Yeats J. J. Physiol. ( Lond .). 1991; 433: 145-161Crossref PubMed Scopus (301) Google Scholar). To activate the sustained DRASIC current, the pH has to become very acidic (pH 4; Fig. 3 h), while a tonic response in sensory neurons is already obtained at pH 6 (1Bevan S. Yeats J. J. Physiol. ( Lond .). 1991; 433: 145-161Crossref PubMed Scopus (301) Google Scholar). Furthermore, both the rapidly inactivating and the sustained phase of the DRASIC current are highly selective for Na+, while in sensory neurons a transient Na+-selective current is followed by a sustained current that discriminates only poorly between Na+ and K+ (1Bevan S. Yeats J. J. Physiol. ( Lond .). 1991; 433: 145-161Crossref PubMed Scopus (301) Google Scholar). Those differences between the DRASIC current and the native current indicate that more than just DRASIC is required to form the non-inactivating H+-gated cation channel in sensory neurons. H+-gated sustained Na+-selective currents were never reported in sensory neurons, where DRASIC is well expressed, suggesting that DRASIC in sensory neurons has indeed properties distinct from the DRASIC channel expressed in COS cells. This might be due either to a specific posttranslational modification, such as phosphorylation, or to an association with other subunits. Heteromultimeric association of homologous is found with ion channels M. S. Neurosci. 1994; 17: PubMed Scopus Google Scholar, C. S. C. Buell G. A. Nature. 1995; PubMed Scopus Google Scholar) and might be the link between the DRASIC subunit and the sustained current recorded in sensory neurons. Furthermore, of DRASIC, the amiloride-sensitive Na+ channel C. Schild L. Buell G. Thorens B. Gautschi I. Horisberger J.D. Rossier B.C. Nature. 1994; 367: 463-467Crossref PubMed Scopus (1775) Google Scholar, 15Lingueglia E. Renard S. Waldmann R. Voilley N. Champigny G. Plass H. Lazdunski M. Barbry P. J. Biol. Chem. 1994; 269: 13736-13739Abstract Full Text PDF PubMed Google Scholar, 16Waldmann R. Champigny G. Bassilana F. Voilley N. Lazdunski M. J. Biol. Chem. 1995; 270: 27411-27414Abstract Full Text Full Text PDF PubMed Scopus (252) Google Scholar, 18Voilley N. Bassilana F. Mignon C. Merscher S. Mattei M.G. Carle G.F. Lazdunski M. Barbry P. Genomics. 1995; 28: 560-565Crossref PubMed Scopus (88) Google Scholar) and the of (19Huang M. Chalfie M. Nature. 1994; 367: 467-470Crossref PubMed Scopus (345) Google Scholar), homologous for and it be if this not be the for the H+-gated cation channels. ASIC, that is also expressed in sensory neurons (7Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1148) Google Scholar), is not the of DRASIC since of both currents that can be by two independent channels (not blot and in Northern blot with 4 μg of total RNA of rat and 4 μg of poly(A+) RNA from rat in situ distribution of DRASIC mRNA in sections of adult rat indicate the abundance high of the Expression of the DRASIC transcript in sections of dorsal root ganglia from rats detected with indicate abundance of the DRASIC transcript in primary cultures of DRG neurons detected with a labeled probe. the of small of DRASIC in COS cells. current in response to a rapid drop in pH from to 4 recorded at of the and the sustained current recorded in the of both components are +32 ± 3 mV (n = Na+ potential at unitary currents recorded from an outside-out at mV and exposed to a drop in pH from to of the unitary sustained current. The slope conductance is 12.6 ± 0.2 the current at +62 ± 2 are from three currents in response to a drop in pH from to in the presence and absence of 200 current as a function of the amiloride pH were from pH to pH currents recorded after a drop of the pH from resting pH to pH and sustained current as a function of is expressed as a of the of the current = sustained current = and sustained current as a function of resting pH. were to pH current = sustained current = The in the ± from at between the to a slow or a rapid in pH. The slow by the was obtained by slowly approaching the cell with the outlet of the perfusion from a distance of while the rapid was induced by opening the perfusion at a distance of ∼50 μm from the cell. were recorded from COS cells using either the pipette with mm extracellular mm Na+ or the outside-out patch-clamp with mm Na+ in the bath solution mm Na+ in the A of H+-gated cation channels is described in both sensory neurons (1Bevan S. Yeats J. J. Physiol. ( Lond .). 1991; 433: 145-161Crossref PubMed Scopus (301) Google Scholar, 4Krishtal O.A. Pidoplichko V.I. Neuroscience. 1981; 6: 2599-2601Crossref PubMed Scopus (154) Google Scholar, 5Konnerth A. Lux H.D. Morad M. J. Physiol. ( Lond .). 1987; 386: 603-633Crossref PubMed Scopus (155) Google Scholar, 6Akaike N. Ueno S. Prog. Neurobiol. 1994; 43: 73-83Crossref PubMed Scopus (50) Google Scholar) and in neurons of the central nervous system (6Akaike N. Ueno S. Prog. Neurobiol. 1994; 43: 73-83Crossref PubMed Scopus (50) Google Scholar, R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1148) Google Scholar, 8Grantyn R. Perouansky M. Rodriguez-Tebar A. Lux H.D. Dev. Brain Res. 1989; 49: 150-155Crossref PubMed Scopus (29) Google Scholar, S. Nakaye T. Akaike N. J. Physiol. ( Lond .). 1992; 447: 309-327Crossref PubMed Scopus (50) Google Scholar). is likely that of this ion channel family be in the The of and proteins should the of H+-gated cation channel expressed in the type of and might to the of subunit with properties identical to the native H+-gated channels. The of that with DRASIC is of of the potential of sustained H+-gated cation currents for the prolonged sensation of pain caused by acids. The of that are selective for a H+-gated cation channel specific for sensory neurons, such as DRASIC, might to the of We are very to Lingueglia for and to and for for and for with the

MDEG1 is a cation channel expressed in brain that belongs to the degenerin/epithelial Na+channel superfamily. It is activated by the same mutations which cause neurodegeneration in Caenorhabditis elegans if present in the degenerins DEG-1, MEC-4, and MEC-10. MDEG1 shares 67% sequence identity with the recently cloned proton-gated cation channel ASIC (acid sensing ion channel), a new member of the family which is present in brain and in sensory neurons. We have now identified MDEG1 as a proton-gated channel with properties different from those of ASIC. MDEG1 requires more acidic pH values for activation and has slower inactivation kinetics. In addition, we have cloned from mouse and rat brain a splice variant form of the MDEG1 channel which differs in the first 236 amino acids, including the first transmembrane region. This new membrane protein, which has been called MDEG2, is expressed in both brain and sensory neurons. MDEG2 is activated neither by mutations that bring neurodegeneration once introduced in C. elegansdegenerins nor by low pH. However, it can associate both with MDEG1 and another recently cloned H+-activated channel DRASIC to form heteropolymers which display different kinetics, pH dependences, and ion selectivities. Of particular interest is the subunit combination specific for sensory neurons, MDEG2/DRASIC. In response to a drop in pH, it gives rise to a biphasic current with a sustained current which discriminates poorly between Na+and K+, like the native H+-gated current recorded in dorsal root ganglion cells. This sustained current is thought to be required for the tonic sensation of pain caused by acids. MDEG1 is a cation channel expressed in brain that belongs to the degenerin/epithelial Na+channel superfamily. It is activated by the same mutations which cause neurodegeneration in Caenorhabditis elegans if present in the degenerins DEG-1, MEC-4, and MEC-10. MDEG1 shares 67% sequence identity with the recently cloned proton-gated cation channel ASIC (acid sensing ion channel), a new member of the family which is present in brain and in sensory neurons. We have now identified MDEG1 as a proton-gated channel with properties different from those of ASIC. MDEG1 requires more acidic pH values for activation and has slower inactivation kinetics. In addition, we have cloned from mouse and rat brain a splice variant form of the MDEG1 channel which differs in the first 236 amino acids, including the first transmembrane region. This new membrane protein, which has been called MDEG2, is expressed in both brain and sensory neurons. MDEG2 is activated neither by mutations that bring neurodegeneration once introduced in C. elegansdegenerins nor by low pH. However, it can associate both with MDEG1 and another recently cloned H+-activated channel DRASIC to form heteropolymers which display different kinetics, pH dependences, and ion selectivities. Of particular interest is the subunit combination specific for sensory neurons, MDEG2/DRASIC. In response to a drop in pH, it gives rise to a biphasic current with a sustained current which discriminates poorly between Na+and K+, like the native H+-gated current recorded in dorsal root ganglion cells. This sustained current is thought to be required for the tonic sensation of pain caused by acids. The protein MDEG (or BNaC1) was cloned from rat and human brain (1Waldmann R. Champigny G. Voilley N. Lauritzen I. Lazdunski M. J. Biol. Chem. 1996; 271: 10433-10436Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar, 2Price M.P. Snyder P.M. Welsh M.J. J. Biol. Chem. 1996; 271: 7879-7882Abstract Full Text Full Text PDF PubMed Scopus (293) Google Scholar, 3Garcı́a-Añoveros J. Derfler B. Neville-Golden J. Hyman B.T. Corey D.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 1459-1464Crossref PubMed Scopus (296) Google Scholar). It is a member of the degenerin/epithelial Na+channel superfamily which includes sodium-permeable ion channels such as the epithelial Na+ channel (ENaC) 1The abbreviations used are: ENaC, epithelial Na+ channel; ASIC, acid sensing ion channel; PCR, polymerase chain reaction; PBS, phosphate-buffered saline; MES, 4-morpholinoethanesulfonic acid. (4Lingueglia E. Voilley N. Waldmann R. Lazdunski M. Barbry P. FEBS Lett. 1993; 318: 95-99Crossref PubMed Scopus (321) Google Scholar, 5Lingueglia E. Renard S. Waldmann R. Voilley N. Champigny G. Plass H. Lazdunski M. Barbry P. J. Biol. Chem. 1994; 269: 13736-13739Abstract Full Text PDF PubMed Google Scholar, 6Canessa C.M. Horisberger J.D. Rossier B.C. Nature. 1993; 361: 467-470Crossref PubMed Scopus (835) Google Scholar, 7Canessa C. Schild L. Buell G. Thorens B. Gautschi I. Horisberger J.D. Rossier B.C. Nature. 1994; 367: 463-467Crossref PubMed Scopus (1789) Google Scholar), involved in sodium homeostasis as well as in taste perception (8Barbry P. Hofman P. Am. J. Physiol. 1997; 273: G571-G587PubMed Google Scholar), and the FMRFamide-activated Helix aspersa channel FaNaC (9Lingueglia E. Champigny G. Lazdunski M. Barbry P. Nature. 1995; 378: 730-733Crossref PubMed Scopus (353) Google Scholar), involved in neurotransmission. It also includes the degenerins ofCaenorhabditis elegans, involved in mechano-transduction (10Driscoll M. Chalfie M. Nature. 1991; 349: 588-593Crossref PubMed Scopus (461) Google Scholar, 11Huang M. Chalfie M. Nature. 1994; 367: 467-470Crossref PubMed Scopus (347) Google Scholar). Rat MDEG did not display detectable currents after expression in Xenopus oocytes or HEK cells (1Waldmann R. Champigny G. Voilley N. Lauritzen I. Lazdunski M. J. Biol. Chem. 1996; 271: 10433-10436Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar). In contrast, a large sodium-selective current was observed in cells that expressed mutated MDEG (1Waldmann R. Champigny G. Voilley N. Lauritzen I. Lazdunski M. J. Biol. Chem. 1996; 271: 10433-10436Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar). The mutations correspond to substitution of a glycine,i.e. a small amino acid for a large amino acid, such as a valine or a phenylalanine, just before the second hydrophobic region. These mutations are equivalent to those which in the C. elegans degenerins cause cell swelling and neuronal death (10Driscoll M. Chalfie M. Nature. 1991; 349: 588-593Crossref PubMed Scopus (461) Google Scholar, 11Huang M. Chalfie M. Nature. 1994; 367: 467-470Crossref PubMed Scopus (347) Google Scholar, 12Hall D.H. Gu G. Garcı́a-Añoveros J. Gong L. Chalfie M. Driscoll M. J. Neurosci. 1997; 17: 1033-1045Crossref PubMed Google Scholar). MDEG shares 67% sequence identity with the recently cloned ASIC channel (for acid sensing ion channel), another member of the ENaC/FaNaC/degenerin family (13Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1155) Google Scholar). ASIC expression yields a transient amiloride-sensitive inward current in response to a rapid drop in extracellular pH, that is mostly carried by Na+ ions (13Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1155) Google Scholar). It is found in both the central and peripheral nervous system (3Garcı́a-Añoveros J. Derfler B. Neville-Golden J. Hyman B.T. Corey D.P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 1459-1464Crossref PubMed Scopus (296) Google Scholar, 13Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1155) Google Scholar). More recently, a second H+-gated Na+ channel, called DRASIC, was found to be expressed specifically in dorsal root ganglion cells (14Waldmann R. Bassilana F. de Weille J. Champigny G. Heurteaux C. Lazdunski M. J. Biol. Chem. 1997; 272: 20975-20978Abstract Full Text Full Text PDF PubMed Scopus (477) Google Scholar). Expression of DRASIC in either Xenopusoocytes or COS cells gives rise to a H+-inducible current with a dual time course comprising a rapidly inactivating current, followed by a slowly activating and sustained current (14Waldmann R. Bassilana F. de Weille J. Champigny G. Heurteaux C. Lazdunski M. J. Biol. Chem. 1997; 272: 20975-20978Abstract Full Text Full Text PDF PubMed Scopus (477) Google Scholar). Both components are essentially Na+ currents. Fast drops in extracellular pH have been shown to activate transient sodium currents in peripheral sensory neurons (15Krishtal O.A. Pidoplichko V.I. Neuroscience. 1980; 5: 2325-2327Crossref PubMed Scopus (384) Google Scholar) and various central neurons (16Grantyn R. Perouansky M. Rodriguez-Tebar A. Lux H.D. Dev. Brain Res. 1989; 49: 150-155Crossref PubMed Scopus (29) Google Scholar, 17Ueno S. Nakaye T. Akaike N. J. Physiol. 1992; 447: 309-327Crossref PubMed Scopus (50) Google Scholar). Whereas the proton-gated current in brain neurons consists of a single rapidly inactivating component, a dual current is found in polymodal nociceptive dorsal root ganglion neurons (18Bevan S. Yeats J. J. Physiol. 1991; 433: 145-161Crossref PubMed Scopus (304) Google Scholar). In these neurons, the transient H+-induced Na+current is followed by a sustained component. This sustained current is most likely the base element in the perception of non-adaptive painful stimuli (19Bevan S. Geppetti P. Trends Neurosci. 1994; 17: 509-512Abstract Full Text PDF PubMed Scopus (301) Google Scholar, 20Steen K.H. Steen A.E. Reeh P.W. J. Neurosci. 1995; 15: 3982-3989Crossref PubMed Google Scholar). Although the biphasic kinetics closely resemble those of the DRASIC channel, differences remain concerning the selectivity of the sustained component of the current, the native one being a non-selective rather than a Na+-selective current. In this study we will show that MDEG (now designated as MDEG1) expressed in COS cells corresponds to a proton-gated cation channel with properties different from ASIC or DRASIC. We will also describe the molecular cloning, localization, and functional expression of a splice variant of the MDEG1 subunit, MDEG2, which has major structural differences with MDEG1. MDEG2 is not active by itself, but it can associate with either MDEG1 or DRASIC, modifying their properties. In particular it will be demonstrated that this splice variant confers non-selectivity to the late H+-induced current. A fragment of the expressed sequence tag (GenBank accession number W50528) was amplified by PCR and used to screen a mouse brain cDNA library (Stratagene). A clone of 3062 base pairs was sequenced on both strands. It displays an open reading frame of 1689 nucleotides preceded by stop codons. The rat cDNA was obtained by PCR with the Expand High fidelity PCR System (Boehringer Mannheim) using a primer flanking the start codon (GCCTCGGGCTGAATGAATG) and a primer positioned 223 base pairs downstream from the stop codon (GTTAGTTCTTGGACAGTTC). After subcloning in pBluescript SK−vector (Stratagene), two independent clones were sequenced on both strands. All nucleic acid positions in the text refer to the rat nucleic acid sequence submitted to EMBL (accession numbers Y14635 for the rat clone and Y14634 for the mouse clone). MDEG2 rat cDNA in pBluescript vector was cut by BamHI, blunt ended, ligated with EcoRI linkers, and cut again byEcoRI and AccI. TheEcoRI/AccI part of the wild-type or mutated MDEG1 cDNAs in pBSK-SP6-globin vector (1Waldmann R. Champigny G. Voilley N. Lauritzen I. Lazdunski M. J. Biol. Chem. 1996; 271: 10433-10436Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar) was replaced by the previously prepared EcoRI/AccI fragment of the MDEG2 cDNAs. For expression in mammalian cells, the MDEG2 cDNA was excised from the pBluescript vector by XbaI andAccI. MDEG1 cDNA in pBSK-SP6-globin was cut byXhoI, blunt ended, and cut again by AccI. The fragment was subcloned with the MDEG2 XbaI/AccI fragment into the XbaI/SmaI-digested PCI expression vector (Promega). Human multi-tissue Northern blots containing about 2 μg of poly(A)+ RNA per lane (normalized for identical β-actin expression) were purchased fromCLONTECH. For the blots with RNAs from rat, total RNA was isolated as described (21Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63232) Google Scholar). 10 μg of total RNA in each lane were separated on 1% agarose/formaldehyde gels and transferred onto nylon membranes. The probes were random primed 32P-labeled and correspond to bases 276 to 585 for the MDEG2 5′ probe, bases 154 to 612 for the MDEG1 5′ probe, bases 217 to 1363 for the rat, and bases 1 to 1308 for the human MDEG1 probe overlapping MDEG2. The human blots were hybridized overnight at 65 °C in 5 × SSC, 10 × Denhardt's solution, 0.1% SDS, 100 μg/ml fish sperm DNA, washed with 0.1 × SSC, 0.1% SDS at 70 °C and exposed to Kodak X-Omat AR film for 3–5 days at The rat blots were hybridized overnight at °C in 5 × SSC, 5 × Denhardt's solution, 0.1% SDS, 100 μg/ml fish sperm DNA, washed with × SSC, 0.1% SDS at 65 °C and with a to the were on using C. C. Lazdunski M. Proc. Natl. Acad. Sci. U. S. A. 1993; PubMed Scopus Google Scholar). were in 0.1 sodium phosphate-buffered pH for and overnight at °C in a were cut on a at on and at °C to the rat cDNA sequence of MDEG2 and or MDEG1 and were used to MDEG2 and MDEG1 The of the used were the were with by to an specific of × were with 0.1 in for 10 for 5 μg/ml in 0.1 for at for 5 were 10 in PBS, for 10 in in and was carried overnight at °C in μg/ml sperm DNA, 1% μg/ml in 2 × SSC, and the probe with specific of × After were washed in 1 × at for before and to for were in with and exposed were with and The of was by in using of the probe with a of and by the of two specific probes to MDEG2 expression in dorsal root was obtained from in with the cDNA to bases with with and of with was carried the from The MDEG1 and DRASIC were amplified by PCR and subcloned in the PCI as described previously (13Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1155) Google Scholar, R. Bassilana F. de Weille J. Champigny G. Heurteaux C. Lazdunski M. J. Biol. Chem. 1997; 272: 20975-20978Abstract Full Text Full Text PDF PubMed Scopus (477) Google Scholar). cells, at a of were with the ASIC and an expression vector containing the cDNA using the were used for days after cells were by their to G. 1994; 17: Google Scholar). currents were recorded using either the cell or and on for The 10 For the solution, was replaced by The in 10 in extracellular pH were by one of of a system in of the cell or a pH of than were with 10 rather than but were identical in were carried at 2 °C cDNA sequence from mouse to that of MDEG1 cDNA was found in the base of expressed sequence (GenBank accession number A fragment of this sequence was amplified by PCR from mouse brain cDNA and used to screen a mouse brain cDNA clones were isolated and the one base was It an open reading frame of 1689 base pairs preceded by stop and for a protein of amino acids. by PCR of the rat cDNA differences at amino with the mouse sequence and in the mouse were replaced by and in the The part of the sequence from amino acid 236 to the of the protein is identical to the rat MDEG1 sequence identity was also found at the nucleic acid from and including the The of between MDEG1 and MDEG2 cDNAs a splice This that from a single two for MDEG1 and the new protein MDEG2. The first acid sequence of MDEG2 by with MDEG1 identity and MDEG2 also two transmembrane one identical to MDEG1 and one different from MDEG1 this protein has the of the two hydrophobic flanking a large including a that was shown to be extracellular for the epithelial Na+ channel C.M. Rossier B.C. Am. J. Physiol. 1994; PubMed Google Scholar, S. E. Voilley N. Lazdunski M. Barbry P. J. Biol. Chem. 1994; 269: Full Text PDF PubMed Google Scholar, P.M. Welsh M.J. J. Biol. Chem. 1994; 269: Full Text PDF PubMed Google Scholar) and for the C. M. Chalfie M. Driscoll M. J. Biol. 1996; PubMed Scopus Google Scholar). Northern was on human and on rat brain with a probe overlapping the of MDEG1 and MDEG2 with two probes specific of each splice variant The two of and by the probe in human and rat brain shown by correspond to each splice the to the MDEG1 form and the to the MDEG2 form Of the by Northern both splice variant are expressed in brain 2 A more of MDEG1 and MDEG2 in the nervous system was by in of the of MDEG1 and MDEG2 was on film and of rat cut in and The of MDEG2 or MDEG1 identical MDEG2 or MDEG1 and of the MDEG2 were found in the of the neuronal but were not in cells. expression in the and and In the system cells MDEG2 were in the cell the and the and cell the were to the cells. In contrast, was observed in the and the In the the large neurons were in as well as in the small cells to or cells. In the MDEG2 were expressed in cells and neurons, as well as in cells of In addition, were observed in large in and of the the and of MDEG2 In the cells and cells of MDEG2 The molecular was in small neurons with a and to and cells. expression was in the large neurons of A expression was observed most including and of the and MDEG2 were expressed at low in MDEG2 was in the same brain as MDEG1 and the that the two can be present in the same neurons and can with each High MDEG2 expression was also observed in sensory neurons of the dorsal root and MDEG1 was not that cause of in the C. elegansdegenerins and neurodegeneration are to activate MDEG1 (1Waldmann R. Champigny G. Voilley N. Lauritzen I. Lazdunski M. J. Biol. Chem. 1996; 271: 10433-10436Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar). These mutations are just before the second hydrophobic in a MDEG1 and MDEG2 are the same 1 and 2 The two mutations and were introduced in MDEG2. these mutations are to activate MDEG1 (1Waldmann R. Champigny G. Voilley N. Lauritzen I. Lazdunski M. J. Biol. Chem. 1996; 271: 10433-10436Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar), MDEG2 were not active after expression in Xenopus oocytes differences in the part of MDEG1 and MDEG2 which includes the first 236 amino and the first transmembrane have differences between the properties of the two MDEG The of sequence identity between MDEG1 or MDEG2, and ASIC and the that are proton-gated ion of COS cells with MDEG1 a proton-gated Na+ current with properties different from both ASIC and DRASIC A and MDEG1 requires more acidic pH values for activation and to open at pH a pH ASIC and DRASIC are activated (13Waldmann R. Champigny G. Bassilana F. Heurteaux C. Lazdunski M. Nature. 1997; 386: 173-177Crossref PubMed Scopus (1155) Google R. Bassilana F. de Weille J. Champigny G. Heurteaux C. Lazdunski M. J. Biol. Chem. 1997; 272: 20975-20978Abstract Full Text Full Text PDF PubMed Scopus (477) Google Scholar). The inactivation kinetics of MDEG1 are slower than for ASIC of COS cells with MDEG2 did not a proton-gated current, at the low pH of MDEG2 is by MDEG2 and ASIC are present in the same and dorsal root ganglion cells, of the two in COS cells was It H+-gated currents that were not different from those recorded with ASIC of MDEG2 and MDEG1 to a new current that activated the pH was from to 5 The current by the acid to pH 5 a slowly inactivating component that was not on expression of MDEG1 after a of to the of pH, a small but current be recorded from most cells the pH currents and at pH the current not This is in with the MDEG1 current which at a pH between and These that MDEG2 with MDEG1 to form with new properties. the of the current at pH is of the MDEG1 current activated at the same pH it is that if not channels are expressed in the form in cells with both MDEG1 and MDEG2. in inactivation of the current was between MDEG1 and currents currents were recorded from excised from cells and from cells. In both it was found that a be recorded The currents at 2 for both MDEG1 and that the MDEG1 and are to The between and is 2 for MDEG1 and 2 for excised from COS cells were exposed to a drop in pH from the pH of to pH Na+ was from the and were at and the MDEG1 current inward the pH the current This that channel of the transient component and of the component are Both current components expressed by the are by of the epithelial Na+ channel It has been shown previously that the DRASIC current, like the native proton-gated current in dorsal root sensory neurons, consists of two a rapidly inactivating current followed by a sustained current (14Waldmann R. Bassilana F. de Weille J. Champigny G. Heurteaux C. Lazdunski M. J. Biol. Chem. 1997; 272: 20975-20978Abstract Full Text Full Text PDF PubMed Scopus (477) Google Scholar). However, the native current, the two DRASIC components at the same membrane of and MDEG2 is present in dorsal root ganglion cells, we the that of DRASIC and MDEG2 a late non-selective current, an transient sodium-selective current. show that of the two different a current which at first like a current. The transient current by activation of at with the it at a well in the of Na+ and the transient current is mostly carried by The current, to in the or of that it is not a Na+-selective current. It has been shown previously that the pH for activation of the DRASIC current is at (14Waldmann R. Bassilana F. de Weille J. Champigny G. Heurteaux C. Lazdunski M. J. Biol. Chem. 1997; 272: 20975-20978Abstract Full Text Full Text PDF PubMed Scopus (477) Google Scholar). It was found that with MDEG2 did not the pH of the current The that the sustained current to independent of the Na+ that the sustained non-selective current to the was not by the of the DRASIC sustained current. It that the transient Na+ current recorded from cells be a current from the of a as in the of the current, both the and the non-selective current A a single channel protein displays two different ion is not It has been described previously for the A. F. E. Buell G. 1996; 272: PubMed Scopus Google Scholar). is the molecular for the of the and the to 2 different of A first is that a single channel selectivity with the of the different to different different of one and one be that the 2 different of channel expression be to differences in if the non-selective channel be from Na+-selective by we for the well as a of membrane the of that be separated into two independent channel it that in the between and both a Na+-selective and a non-selective be These not a However, it was shown that the is for it likely that the non-selective current is with a channel of In the DRASIC be found between the of the and sustained current. In cells the sustained current was of cells, the sustained component was than of the in of the sustained component was at of the current. This in of the the of 2 different for ion channels Trends Sci. 1996; 17: Full Text PDF PubMed Google Scholar), in the H+-gated channel family can be by and MDEG2 is present in sensory neurons it the expression of DRASIC. of the two yields a H+-gated current that now a non-selective sustained component. it that these two at part of the native proton-gated channel of nociceptive neurons (18Bevan S. Yeats J. J. Physiol. 1991; 433: 145-161Crossref PubMed Scopus (304) Google Scholar). The expression of acid sensing ion channels is not to sensory neurons. ASIC (14Waldmann R. Bassilana F. de Weille J. Champigny G. Heurteaux C. Lazdunski M. J. Biol. Chem. 1997; 272: 20975-20978Abstract Full Text Full Text PDF PubMed Scopus (477) Google Scholar), both MDEG1 and MDEG2 are well expressed in the brain and MDEG1 is in present in the in extracellular pH have been shown to be with neuronal M. Trends Neurosci. 1992; 15: Full Text PDF PubMed Scopus (477) Google Scholar), the that brain ion channels are involved in or However, the acid for activation of MDEG1 by pH not to be with a as an acid The also is at acidic pH. It is not MDEG1 channels or in their native can associate with or can be by such as to bring their pH to pH the of MDEG1 channels in the brain remain Both MDEG1 and channels can be activated in such as and which large of the extracellular C. J. 49: PubMed Scopus Google Scholar). In such the of these particular channels and the non-selective cation current by the have to neuronal cell We are to G. Champigny and P. Barbry for We C. G. M. and N. for their for and F. for with the

Acid sensing is associated with nociception, taste transduction, and perception of extracellular pH fluctuations in the brain. Acid sensing is carried out by the simplest class of ligand-gated channels, the family of H(+)-gated Na(+) channels. These channels have recently been cloned and belong to the acid-sensitive ion channel (ASIC) family. Toxins from animal venoms have been essential for studies of voltage-sensitive and ligand-gated ion channels. This paper describes a novel 40-amino acid toxin from tarantula venom, which potently blocks (IC(50) = 0.9 nm) a particular subclass of ASIC channels that are highly expressed in both central nervous system neurons and sensory neurons from dorsal root ganglia. This channel type has properties identical to those described for the homomultimeric assembly of ASIC1a. Homomultimeric assemblies of other members of the ASIC family and heteromultimeric assemblies of ASIC1a with other ASIC subunits are insensitive to the toxin. The new toxin is the first high affinity and highly selective pharmacological agent for this novel class of ionic channels. It will be important for future studies of their physiological and physio-pathological roles.