Activation of p27Kip1 Expression by E2F1
Abstract
The E2F1 transcription factor is a critical regulator of cell cycle due to its ability to promote S phase entry. However, E2F1 overexpression also sensitizes cells to apoptosis and E2F1-null mice are predisposed to tumor development, suggesting that it also has properties of a growth suppressor. E2F1 transcription function is regulated by interaction with hypophosphorylated pRb. Cdk inhibitors such as p16INK4a and p27Kip1 inhibit pRb phosphorylation by the cyclin D/Cdk4 and cyclin E/Cdk2 complexes, thus keeping E2F1 in an inactive state. We found that E2F1 binds to the p27 promoter in vivo and activates p27 mRNA and protein expression. Depletion of endogenous E2F1 by siRNA causes a reduction in basal p27 expression level. Inhibition of endogenous p27 expression by siRNA increases E2F1 transcriptional activity and permits accelerated cell cycle progression by exogenous E2F1. These observations suggest that induction of p27 acts as a negative feedback mechanism for E2F1 and may also contribute to other functions of E2F1. The E2F1 transcription factor is a critical regulator of cell cycle due to its ability to promote S phase entry. However, E2F1 overexpression also sensitizes cells to apoptosis and E2F1-null mice are predisposed to tumor development, suggesting that it also has properties of a growth suppressor. E2F1 transcription function is regulated by interaction with hypophosphorylated pRb. Cdk inhibitors such as p16INK4a and p27Kip1 inhibit pRb phosphorylation by the cyclin D/Cdk4 and cyclin E/Cdk2 complexes, thus keeping E2F1 in an inactive state. We found that E2F1 binds to the p27 promoter in vivo and activates p27 mRNA and protein expression. Depletion of endogenous E2F1 by siRNA causes a reduction in basal p27 expression level. Inhibition of endogenous p27 expression by siRNA increases E2F1 transcriptional activity and permits accelerated cell cycle progression by exogenous E2F1. These observations suggest that induction of p27 acts as a negative feedback mechanism for E2F1 and may also contribute to other functions of E2F1. Progression of mammalian cells through normal cell cycle requires coordinated actions of positive and negative factors. Mitogenic signals stimulate sequential assembly and activation of cyclin D/Cdk4/6 and cyclin E/Cdk2 in early and late G1, resulting in the phosphorylation of pRb retinoblastoma protein and release of E2F transcription factors. The seven members of the E2F gene family play central roles in controlling S phase entry (1.Dyson N. Genes Dev. 1998; 12: 2245-2262Crossref PubMed Scopus (1981) Google Scholar). Among the E2F proteins, E2F1, -2, and -3A promote cell growth, while E2F3B, -4, -5, -6, and -7 act as negative regulators (1.Dyson N. Genes Dev. 1998; 12: 2245-2262Crossref PubMed Scopus (1981) Google Scholar, 2.Gaubatz S. Lindeman G.J. Ishida S. Jakoi L. Nevins J.R. Livingston D.M. Rempel R.E. Mol. Cell. 2000; 6: 729-735Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar). E2Fs are inactivated by binding to the retinoblastoma family of pocket proteins. Hyperphosphorylation of pRb releases E2F1, which initiates transcription of genes required for G1/S transition, such as cyclin A, cyclin D, cyclin E, c-myc, c-myb, and DNA polymerase (1.Dyson N. Genes Dev. 1998; 12: 2245-2262Crossref PubMed Scopus (1981) Google Scholar). Subsequent activation of cyclin A/Cdk2 and cyclin B/Cdk1 complexes are important for completion of mitosis. The activities of cyclin/Cdk complexes are negatively regulated by Cdk inhibitors, including the INK4 family (p15INK4b, p16INK4a, p18INK4c, and p19INK4d) and Cip/Kip family (p21Cip1, p27Kip1, and p57Kip2). The INK4 family mainly inhibits cyclin D/Cdk4 complex and Cip/Kip family mainly targets cyclin E/cdk2. p27 is regulated at the levels of transcription and protein turnover. Proteolysis by the ubiquitin-dependent proteasome pathway is thought to be the predominant mechanism that regulates p27 levels. This occurs through phosphorylation at Thr187 by cyclin E/Cdk2 and subsequent recognition by ubiquitin ligase SCF Skp2 (3.Montagnoli A. Fiore F. Eytan E. Carrano A.C. Draetta G.F. Hershko A. Pagano M. Genes Dev. 1999; 13: 1181-1189Crossref PubMed Scopus (512) Google Scholar, 4.Carrano A.C. Eytan E. Hershko A. Pagano M. Nat. Cell Biol. 1999; 1: 193-199Crossref PubMed Scopus (1339) Google Scholar). Cytoplasmic mislocalization of p27 may also lead to loss of function (5.Ciaparrone M. Yamamoto H. Yao Y. Sgambato A. Cattoretti G. Tomita N. Monden T. Rotterdam H. Weinstein I.B. Cancer Res. 1998; 58: 114-122PubMed Google Scholar). In addition, p27 activity can be regulated by sequestration by cyclin D/Cdk4/6 complex, which prevents it from inhibiting cyclin E/Cdk2 (6.Bouchard C. Thieke K. Maier A. Saffrich R. Hanley-Hyde J. Ansorge W. Reed S. Sicinski P. Bartek J. Eilers M. EMBO J. 1999; 18: 5321-5333Crossref PubMed Scopus (411) Google Scholar, 7.Perez-Roger I. Kim S.H. Griffiths B. Sewing A. Land H. EMBO J. 1999; 18: 5310-5320Crossref PubMed Scopus (282) Google Scholar). Forkhead transcription factor has been shown to activate p27 transcription and induce cell cycle arrest (8.Dijkers P.F. Medema R.H. Pals C. Banerji L. Thomas N.S. Lam E.W. Burgering B.M. Raaijmakers J.A. Lammers J.W. Koenderman L. Coffer P.J. Mol. Cell. Biol. 2000; 20: 9138-9148Crossref PubMed Scopus (544) Google Scholar, 9.Medema R.H. Kops G.J. Bos J.L. Burgering B.M. Nature. 2000; 404: 782-787Crossref PubMed Scopus (1231) Google Scholar). Given its important roles in cell cycle regulation, p27 is likely to be controlled by multiple transcription factors that coordinate its expression with cell cycle progression. Disruption of p27Kip1 locus in mice results in increased animal size due to increase in cell proliferation (10.Fero M.L. Rivkin M. Tasch M. Porter P. Carow C.E. Firpo E. Polyak K. Tsai L.H. Broudy V. Perlmutter R.M. Kaushansky K. Roberts J.M. Cell. 1996; 85: 733-744Abstract Full Text Full Text PDF PubMed Scopus (1342) Google Scholar). Furthermore, p27Kip1-deficient mice also showed increased tumorigenesis after genotoxic or oncogenic insults (11.Fero M.L. Randel E. Gurley K.E. Roberts J.M. Kemp C.J. Nature. 1998; 396: 177-180Crossref PubMed Scopus (685) Google Scholar, 12.Jackson R.J. Adnane J. Coppola D. Cantor A. Sebti S.M. Pledger W.J. Oncogene. 2002; 21: 8486-8497Crossref PubMed Scopus (68) Google Scholar), suggesting that it can function as a tumor suppressor gene. Consistent with this notion, reduced levels of p27 expression are frequently observed in human carcinomas and correlate directly with poor prognosis (13.Tsihlias J. Kapusta L. Slingerland J. Annu. Rev. Med. 1999; 50: 401-423Crossref PubMed Scopus (291) Google Scholar). However, p27 has also been shown to promote assembly of active cyclin D/Cdk4 complex in vivo and is part of the active complex (14.Cheng M. Olivier P. Diehl J.A. Fero M. Roussel M.F. Roberts J.M. Sherr C.J. EMBO J. 1999; 18: 1571-1583Crossref PubMed Scopus (974) Google Scholar). Therefore, it is possible that p27 expression plays a role in coordinating cell cycle progression by increasing cyclinD/Cdk4 activity during early G1 phase. Ectopic expression of E2F1 is sufficient to drive quiescent cells into S phase (15.Johnson D.G. Schwarz J.K. Cress W.D. Nevins J.R. Nature. 1993; 365: 349-352Crossref PubMed Scopus (837) Google Scholar). As expected, E2F1 overexpression can cooperate with activated ras in inducing morphological and tumorigenic transformation of rat embryo fibroblasts in culture (16.Johnson D.G. Cress W.D. Jakoi L. Nevins J.R. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 12823-12827Crossref PubMed Scopus (242) Google Scholar), which fits the classic definition of an oncogene. Interestingly, E2F1 also has activities that are opposite to its role as an oncogene. Overexpression of E2F1 in mouse embryo fibroblasts results in abortive S phase and significant apoptosis through p53-dependent and independent mechanisms (17.Kowalik T.F. DeGregori J. Schwarz J.K. Nevins J.R. J. Virol. 1995; 69: 2491-2500Crossref PubMed Google Scholar, 18.Wu X. Levine A.J. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3602-3606Crossref PubMed Scopus (810) Google Scholar). E2F1-null mice develop testicular atrophy and exocrine gland dysplasia (19.Yamasaki L. Jacks T. Bronson R. Goillot E. Harlow E. Dyson N.J. Cell. 1996; 85: 537-548Abstract Full Text Full Text PDF PubMed Scopus (643) Google Scholar, 20.Field S.J. Tsai F.Y. Kuo F. Zubiaga A.M. Kaelin Jr., W.G. Livingston D.M. Orkin S.H. Greenberg M.E. Cell. 1996; 85: 549-561Abstract Full Text Full Text PDF PubMed Scopus (693) Google Scholar), consistent with a growth suppressor function. Since formation of the pRb-E2F1 complex can lead to recruitment of histone deacetylases to E2F1 target promoters and actively repress transcription, loss of the repressive complexes in the E2F1-null mice may partially account for the cell proliferation phenotype. However, E2F1 has well documented target genes that are pro-apoptotic, such as caspase 3, 7, 9 and Apaf1 (21.Nahle Z. Polakoff J. Davuluri R.V. McCurrach M.E. Jacobson M.D. Narita M. Zhang M.Q. Lazebnik Y. Bar-Sagi D. Lowe S.W. Nat. Cell Biol. 2002; 4: 859-864Crossref PubMed Scopus (367) Google Scholar). Furthermore, E2F1 directly induces expression of p19ARF, which in turn activates p53 by binding and inhibiting MDM2 function (22.Bates S. Phillips A.C. Clark P.A. Stott F. Peters G. Ludwig R.L. Vousden K.H. Nature. 1998; 395: 124-125Crossref PubMed Scopus (814) Google Scholar). Therefore, the growth-promoting function of E2F1 is likely to be counter-balanced by multiple self-imposed safeguard mechanisms. In this report, we present evidence that E2F1 can induce expression of p27 through activation of the p27 promoter. E2F1 expression is necessary for maintaining basal level p27 expression in the H1299 tumor cell line. Expression of p27 cooperates with pRb to suppress E2F1 activity, and ablation of endogenous p27 expression enhances E2F1 activity. The results suggest the presence of a novel p27-dependent negative feedback mechanism that regulates E2F1 activity. Cell Lines and Plasmids—H1299 (non-small cell lung carcinoma, p53-null), U2OS (osteosarcoma, wt p53), and NIH3T3 cells were maintained in DMEM medium with 10% fetal bovine serum. To inhibit p27 expression by RNA interference, double-stranded oligonucleotide (5′-GATCCCGTTGAGTAGAAGAATCGTCGGTTTGATATCCGACCGACGATTCTTCTACTCAATTTTTTA, p27 sequence underlined) was cloned into the pSuperiorRetroPuro vector (OligoEngine). The plasmid was packaged into retrovirus by transfection of the amphotropic packaging cell line LA (a kind gift from Dr. Peiqing Sun, the Scripps Institute). H1299 cells were infected with the p27 shRNA retrovirus and selected with 1 μg/ml puromycin for 10 days. Drug-resistant colonies were pooled for analysis. H1299 cells infected with a vector virus without the shRNA insert were also selected and pooled as control. Adenoviruses expressing GFP 1The abbreviations used are: GFP, green fluorescent protein; RT, reverse transcription; IP, immunoprecipitation; ChIP, chromatin IP; FACS, fluorescence-activated cell sorting; 4-OHT, 4-hydroxytamoxifen; siRNA, small interfering RNA. or E2F1 were amplified using 293 cells and cell lysate containing the viruses were used for the infection experiments. Western Blot—Cells were lysed in lysis buffer (50 mm Tris-HCl (pH 8.0), 5 mm EDTA, 150 mm NaCl, 0.5% Nonidet P-40, 1 mm phenylmethylsulfonyl fluoride) and centrifuged for 5 min at 10,000 × g, and the insoluble debris was discarded. Cell lysate (10–50 μg of protein) was fractionated by SDS-PAGE and transferred to Immobilon-P filters (Millipore). The filter was blocked for 1 h with phosphate-buffered saline containing 5% nonfat dry milk, 0.1% Tween 20. p27 was detected using a monoclonal antibody (Clone 57, BD Biosciences). E2F1 was detected using monoclonal antibody KH95 or rabbit polyclonal antibody C-20 (Santa Cruz Biotechnology). ARF was detected using 14PO2 antibody (NeoMarkers). The filter was developed using ECL-plus reagent (Amersham Biosciences). RT-PCR Analysis and Chromatin Immunoprecipitation (ChIP)—Reverse transcription of total RNA was performed using the SuperScript III kit (Invitrogen). The following PCR primers were used: p27F (5′-TAACCCGGGACTTGGAGAAG) and p27R (5′-GCTTCTTGGGCGTCTGCTC) to amplify a 450-bp product and actin F (5′-GCTCGTCGTCGACAACGGCT) and actin R (5′-CAAACATGATCTGGGTCATCTTCTC) to amplify a 353-bp product. To avoid overamplification, samples were retrieved after 15, 20, 25, 30, and 35 PCR cycles and analyzed by agarose gel electrophoresis. Representative results are shown in Fig. 2C. Chromatin immunoprecipitation was carried out using published procedure (23.Boyd K.E. Wells J. Gutman J. Bartley S.M. Farnham P.J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13887-13892Crossref PubMed Scopus (246) Google Scholar). Immortalized mouse embryonic fibroblast 10 (1.Dyson N. Genes Dev. 1998; 12: 2245-2262Crossref PubMed Scopus (1981) Google Scholar) cells were transiently transfected with E2F1 expression plasmid (24.Harvey M. Sands A.T. Weiss R.S. Hegi M.E. Wiseman R.W. Pantazis P. Giovanella B.C. Tainsky M.A. Bradley A. Donehower L.A. Oncogene. 1993; 8: 2457-2467PubMed Google Scholar). E2F1 IP was performed using KH95 antibody. Mock IP was performed with a GFP antibody. Coprecipitated chromatin was analyzed by PCR for the presence of p27 promoter DNA between –615 to –326 using p27PF (5′-CGGCCGTTTGGCTAGTTTGTTTGT) and p27PR (5′-GGAGGCTGACGAAGAAGAAGATGA) primers, generating a 294-bp product. Results at cycle 35 are shown in Fig. 2F. Luciferase Reporter Assay—Cells (50,000/well) were cultured in 24-well plates and transfected with a mixture containing 10 ng luciferase reporter plasmid, 5 ng of CMV-lacZ plasmid, 20 ng of E2F1 expression plasmid, and 50 ng of pRb or p27 plasmid. Transfection was achieved using Lipofectamine PLUS reagents (Invitrogen), and cells were analyzed for luciferase and β-galactosidase expression after 24 h. The ratio of luciferase/β-galactosidase activity was used as an indicator of E2F1 transcription activity. Immunofluorescence Staining and Cell Cycle Analysis—Cells cultured on chamber slides were transfected with E2F1 plasmid for 24 h using Lipofectamine Plus reagents. Cells were fixed for 2 min with 4% paraformaldehyde and incubated with p27 monoclonal antibody and E2F1 rabbit polyclonal antibody C20. Rhodamine-anti-mouse Ig and fluorescein isothiocyanate-anti-rabbit Ig secondary antibodies were used to detect p27 and E2F1 in the cell cycle cells in plates were infected with and at 24 h after cells were with for h to with and analyzed by E2F1 p27 at the of E2F1 transcriptional activity, U2OS and H1299 cells were transiently transfected with E2F1 expression Western showed increase of p27Kip1 expression level after E2F1 of the cells were transfected in a of the tumor suppressor pRb with E2F1 blocked p27 consistent with the ability of pRb to E2F1. showed that E2F1 transfection also p27 expression in cells and the NIH3T3 mouse fibroblast Furthermore, the which inhibits pRb and activates endogenous E2F1, p27 expression in NIH3T3 in cells activated E2F1 due to oncogenic To the ability of E2F1 to induce p27 U2OS cells were transiently transfected with E2F1 plasmid and to for E2F1 and The results showed that cells expressing E2F1 levels of p27 p27 induction with E2F1 the levels of p27 and E2F1 expression in the cells This may be due to the that p27 level is also by other factors such as cell cycle To the of E2F1 transfection on p27 an H1299 cell line expressing was with to activate the E2F1 protein Y. J. M. R. Cress W.D. J. Biol. Full Text Full Text PDF PubMed Scopus Google Scholar). This also in significant increase of p27 expression level In cells with activated E2F1, expression level of E2F1 target was also increased as A. P.J. R. J.A. Genes Dev. 18: PubMed Scopus Google Scholar). These results that p27 expression is regulated by E2F1. E2F1 binding to promoters been shown to inhibit gene expression during and G1, due to recruitment of pRb and the histone complexes (1.Dyson N. Genes Dev. 1998; 12: 2245-2262Crossref PubMed Scopus (1981) Google Scholar). To the role of endogenous E2F1 in p27 expression RNA of E2F1 was H1299 cell line has been that E2F1 siRNA, resulting in reduction of endogenous E2F1 level Y. Cress W.D. Mol. Cancer Google Scholar). of E2F1 expression by siRNA with significant reduction of p27 level in cells of cell growth with H1299 This that endogenous E2F1 is a of basal p27 expression in H1299 cells normal cell culture E2F1 or other E2F family members also negatively p27 expression during growth arrest in in or in with reduced levels of p27 to be of p27 by level of p27 can be controlled at the level of To the of E2F1 on p27 U2OS cells transfected with E2F1 were with to protein and the of p27 was by Western in p27 was observed suggesting that E2F1 may directly p27 expression at the level of This mechanism was by RT-PCR of of by in significant increase in p27 mRNA level To E2F1 activates the promoter of luciferase reporter by a mouse p27 promoter and W. J. in was transfected with E2F1 expression The results showed that the p27 promoter was activated by E2F1 to Fig. In the of p27 promoter activation by E2F1 was to the E2F1 and cyclin promoters in Y. J. M. R. Cress W.D. J. Biol. Full Text Full Text PDF PubMed Scopus Google Scholar). The p27 promoter was also activated by other E2F1 family members that are to be transcription by the inactive Therefore, activation of p27 promoter is a by E2F1 family of the mouse p27 promoter that the between –326 to –615 necessary and sufficient for significant to E2F1 in reporter of this E2F1 binding M.A. 1996; PubMed Scopus Google Scholar). E2F1 binding were also found of this p27 promoter also E2F1 T. J. T. J. Biol. 1999; Full Text Full Text PDF PubMed Scopus Google Scholar). To E2F1 directly binds to the p27 chromatin immunoprecipitation was performed on mouse PCR of chromatin DNA to E2F1 showed the presence of p27 promoter containing the –326 to –615 from suggesting binding by endogenous E2F1. The was increased cells were transfected with E2F1 Therefore, E2F1 may activate p27 transcription by with the E2F1 binding on the promoter. mouse promoter between –326 to –615 the for E2F1 in plasmid reporter E2F1 may also play a role in a the promoter were active in reporter be to the mechanism of p27 by E2F1 and other E2F family members in of the cell cycle and in to growth The transcriptional activity of E2F1 is controlled by which is in turn regulated by cyclin We that E2F1 induction of p27 expression may a negative feedback to the activity of E2F1 To this is the cyclin promoter was used to the of p27 expression on E2F1 transcription function. of p27 or pRb in of E2F1 function Furthermore, p27 and pRb E2F1 function. In a that the transcription activation of E2F1 was used to activate the of p27 and pRb also the ability of to activate the reporter These results that induction of p27 expression by E2F1 can function as a negative feedback mechanism that E2F1 activity. Inhibition of p27 Expression by siRNA E2F1 the role of endogenous p27 in E2F1 activity, p27 expression in H1299 cells was by expression of a p27 shRNA of H1299 cells with reduction of p27 level was transfected with and E2F1 expression activation of the luciferase was in cells with were observed by transfection of p27 siRNA expression plasmid results that endogenous p27 plays a role in the activity of the transfected E2F1. E2F1 expression has been shown to promote cell cycle entry of quiescent cells (15.Johnson D.G. Schwarz J.K. Cress W.D. Nevins J.R. Nature. 1993; 365: 349-352Crossref PubMed Scopus (837) Google Scholar). of p27 expression by E2F1 may function in the cell cycle of E2F1. To this is the cells were infected with vector expressing E2F1. cells were analyzed for cell cycle progression by after 24 h. To the ability of cells to and S phase was by E2F1 cells were also with the for h to cells from through phase. This to the by which G1 cells and through S G1 cells be S phase. quiescent expression of E2F1 in cells significant on the of cell cycle progression inducing levels of apoptosis However, E2F1 accelerated cell cycle progression in the G1 to of level after the of These results that p27 expression plays a role in the cell cycle activity of E2F1. In the that p27 is a transcriptional target of E2F1. Furthermore, endogenous E2F1 is an important factor in maintaining p27 basal expression level in H1299 The ability of p27 to inhibit E2F1 activity in with pRb as in this and in with the accelerated cell cycle in cells E2F1 expression suggest the presence of a negative feedback that E2F1 activity also showed that in culture and at a or C. M. D. M. C. A. Oncogene. PubMed Scopus Google Scholar), consistent with the that p27 acts as a safeguard mechanism pRb loss and E2F1 of the p27 negative feedback to the cell cycle and a that may be a target of growth of the complex roles of the to its function as a cell cycle p27 has also been shown to promote assembly of active cyclin D/Cdk4 complex in vivo and is part of the active complex (14.Cheng M. Olivier P. Diehl J.A. Fero M. Roussel M.F. Roberts J.M. Sherr C.J. EMBO J. 1999; 18: 1571-1583Crossref PubMed Scopus (974) Google Scholar). Therefore, it is possible that p27 induction by E2F1 plays a role in coordinating cell cycle progression by increasing cyclinD/Cdk4 activity during early G1 phase. Furthermore, E2F1-null mice are predisposed to tumor (19.Yamasaki L. Jacks T. Bronson R. Goillot E. Harlow E. Dyson N.J. Cell. 1996; 85: 537-548Abstract Full Text Full Text PDF PubMed Scopus (643) Google Scholar, 20.Field S.J. Tsai F.Y. Kuo F. Zubiaga A.M. Kaelin Jr., W.G. Livingston D.M. Orkin S.H. Greenberg M.E. Cell. 1996; 85: 549-561Abstract Full Text Full Text PDF PubMed Scopus (693) Google Scholar), suggesting that it also has properties of a growth suppressor. of p27 may contribute to the function of E2F1 in We the and for in and
Related Papers
No related papers found
Powered by citation graph analysis