André Colom

BACKGROUND: A probiotic formulation (Lactobacillus helveticus R0052 and Bifidobacterium longum R0175 combination, Probio'Stick(®) ) displays anxiolytic-like activity and reduces apoptosis in the lymbic system in animal models of depression. Based on the hypothesis that modulation of gut microbiota by this probiotic formulation has beneficial effects on brain activity in stress conditions, we report a set of probiotic-evoked physiological, cellular, and molecular events in the brain of Probio'Stick(®) pretreated mice submitted to chronic psychological stress. METHODS: Water avoidance stress (WAS) was applied or not (sham). Hypothalamic-pituitary-adrenal (HPA) axis and autonomic nervous system (ANS) responses to the chronic stress were assessed through plasma corticosterone and catecholamine measurements. Specific markers for neuronal activity, neurogenesis, and synaptic plasticity were used to assess brain activity. In addition, gut permeability and tight junction (TJ) proteins levels were also determinated. KEY RESULTS: We observed that a pretreatment with the probiotic formulation attenuated HPA axis and ANS activities in response to WAS, and reduced cFos expression in different brain areas but Lactobacillus salivarius (a negative control) treatment was ineffective on these parameters. Moreover, probiotic pretreatment prevented the WAS-induced decrease hippocampal neurogenesis and expression changes in hypothalamic genes involved in synaptic plasticity. These central effects were associated with restoration of TJ barrier integrity in stressed mice. CONCLUSIONS & INFERENCES: These data suggest that chronic stress-induced abnormal brain plasticity and reduction in neurogenesis can be prevented by a pretreatment with the Probio'Stick(®) formulation, suggesting that probiotics modulate neuroregulatory factors and various signaling pathways in the central nervous system involved in stress response.

Objective To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. Design We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis ( Pg ), Fusobacterium nucleatum and Prevotella intermedia . The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Results Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. Conclusions We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis.

Autotaxin (ATX) is a secreted lysophospholipase D that generates the lipid mediator lysophosphatidic acid (LPA). ATX is secreted by adipose tissue and its expression is enhanced in obese/insulin-resistant individuals. Here, we analyzed the specific contribution of adipose-ATX to fat expansion associated with nutritional obesity and its consequences on plasma LPA levels. We established ATXF/F/aP2-Cre (FATX-KO) transgenic mice carrying a null ATX allele specifically in adipose tissue. FATX-KO mice and their control littermates were fed either a normal or a high-fat diet (HFD) (45% fat) for 13 weeks. FATX-KO mice showed a strong decrease (up to 90%) in ATX expression in white and brown adipose tissue, but not in other ATX-expressing organs. This was associated with a 38% reduction in plasma LPA levels. When fed an HFD, FATX-KO mice showed a higher fat mass and a higher adipocyte size than control mice although food intake was unchanged. This was associated with increased expression of peroxisome proliferator-activated receptor (PPAR)γ2 and of PPAR-sensitive genes (aP2, adiponectin, leptin, glut-1) in subcutaneous white adipose tissue, as well as in an increased tolerance to glucose. These results show that adipose-ATX is a negative regulator of fat mass expansion in response to an HFD and contributes to plasma LPA levels. Autotaxin (ATX) is a secreted lysophospholipase D that generates the lipid mediator lysophosphatidic acid (LPA). ATX is secreted by adipose tissue and its expression is enhanced in obese/insulin-resistant individuals. Here, we analyzed the specific contribution of adipose-ATX to fat expansion associated with nutritional obesity and its consequences on plasma LPA levels. We established ATXF/F/aP2-Cre (FATX-KO) transgenic mice carrying a null ATX allele specifically in adipose tissue. FATX-KO mice and their control littermates were fed either a normal or a high-fat diet (HFD) (45% fat) for 13 weeks. FATX-KO mice showed a strong decrease (up to 90%) in ATX expression in white and brown adipose tissue, but not in other ATX-expressing organs. This was associated with a 38% reduction in plasma LPA levels. When fed an HFD, FATX-KO mice showed a higher fat mass and a higher adipocyte size than control mice although food intake was unchanged. This was associated with increased expression of peroxisome proliferator-activated receptor (PPAR)γ2 and of PPAR-sensitive genes (aP2, adiponectin, leptin, glut-1) in subcutaneous white adipose tissue, as well as in an increased tolerance to glucose. These results show that adipose-ATX is a negative regulator of fat mass expansion in response to an HFD and contributes to plasma LPA levels. Autotaxin (ATX) is a secreted lysophospholipase D that catalyzes the hydrolysis of lysophosphatidylcholine into lysophosphatidic acid (LPA), a growth factor-like lipid mediator acting via specific G-protein coupled receptors (1van Meeteren L.A. Moolenaar W.H. Regulation and biological activities of the autotaxin-LPA axis.Prog. Lipid Res. 2007; 46: 145-160Crossref PubMed Scopus (299) Google Scholar, 2Yuelling L.M. Fuss B. Autotaxin (ATX): a multi-functional and multi-modular protein possessing enzymatic lysoPLD activity and matricellular properties.Biochim. Biophys. Acta. 2008; 1781: 525-530Crossref PubMed Scopus (63) Google Scholar, 3Boutin J.A. Ferry G. Autotaxin.Cell. Mol. Life Sci. 2009; 66: 3009-3021Crossref PubMed Scopus (38) Google Scholar). ATX is present in plasma and other biological fluids and is expressed by several organs and tissues but the tissue origin of circulating LPA remains unknown. ATX plays a crucial role in embryonic development because its knockout in mice is lethal due to impaired blood vessel formation and a failure of neural tube closure (4van Meeteren L.A. Ruurs P. Stortelers C. Bouwman P. van Rooijen M.A. Pradere J.P. Pettit T.R. Wakelam M.J. Saulnier-Blache J.S. Mummery C.L. Autotaxin, a secreted lysophospholipase D, is essential for blood vessel formation during development.Mol. Cell. Biol. 2006; 26: 5015-5022Crossref PubMed Scopus (448) Google Scholar, 5Tanaka M. Okudaira S. Kishi Y. Ohkawa R. Iseki S. Ota M. Noji S. Yatomi Y. Aoki J. Arai H. Autotaxin stabilizes blood vessels and is required for embryonic vasculature by producing lysophosphatidic acid.J. Biol. Chem. 2006; 281: 25822-25830Abstract Full Text Full Text PDF PubMed Scopus (387) Google Scholar, 6Fotopoulou S. Oikonomou N. Grigorieva E. Nikitopoulou I. Paparountas T. Thanassopoulou A. Zhao Z. Xu Y. Kontoyiannis D.L. Remboutsika E. ATX expression and LPA signalling are vital for the development of the nervous system.Dev. Biol. 2010; 339: 451-464Crossref PubMed Scopus (120) Google Scholar). So far, ATX has mostly been studied for its role in tumorigenesis, angiogenesis, and metastasis (7Liu S. Murph M. Panupinthu N. Mills G.B. ATX-LPA receptor axis in inflammation and cancer.Cell Cycle. 2009; 8: 3695-3701Crossref PubMed Scopus (84) Google Scholar). Our group has brought ATX into the area of metabolic diseases. We have shown that ATX is abundantly expressed and secreted by adipocytes (8Gesta S. Simon M.F. Rey A. Sibrac D. Girard A. Lafontan M. Valet P. Saulnier-Blache J.S. Secretion of a lysophospholipase D activity by adipocytes: involvement in lysophosphatidic acid synthesis.J. Lipid Res. 2002; 43: 904-910Abstract Full Text Full Text PDF PubMed Google Scholar, 9Ferry G. Tellier E. Try A. Gres S. Naime I. Simon M.F. Rodriguez M. Boucher J. Tack I. Gesta S. Autotaxin is released from adipocytes, catalyzes lysophosphatidic acid synthesis, and activates preadipocyte proliferation. Up-regulated expression with adipocyte differentiation and obesity.J. Biol. Chem. 2003; 278: 18162-18169Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar, 10Pradere J.P. Tarnus E. Gres S. Valet P. Saulnier-Blache J.S. Secretion and lysophospholipase D activity of autotaxin by adipocytes are controlled by N-glycosylation and signal peptidase.Biochim. Biophys. Acta. 2007; 1771: 93-102Crossref PubMed Scopus (35) Google Scholar) and is responsible for the production of LPA in adipose tissue extracellular medium (11Ferry G. Moulharat N. Pradere J.P. Desos P. Try A. Genton A. Giganti A. Beucher-Gaudin M. Lonchampt M. Bertrand M. S32826, a nanomolar inhibitor of autotaxin: discovery, synthesis and applications as a pharmacological tool.J. Pharmacol. Exp. Ther. 2008; 327: 809-819Crossref PubMed Scopus (86) Google Scholar). Nevertheless, the specific contribution of adipose-ATX to circulating LPA remains unknown. ATX expression is increased in adipose tissue from obese/insulin-resistant mice and humans (9Ferry G. Tellier E. Try A. Gres S. Naime I. Simon M.F. Rodriguez M. Boucher J. Tack I. Gesta S. Autotaxin is released from adipocytes, catalyzes lysophosphatidic acid synthesis, and activates preadipocyte proliferation. Up-regulated expression with adipocyte differentiation and obesity.J. Biol. Chem. 2003; 278: 18162-18169Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar, 12Boucher J. Quilliot D. Praderes J.P. Simon M.F. Gres S. Guigne C. Prevot D. Ferry G. Boutin J.A. Carpene C. Potential involvement of adipocyte insulin resistance in obesity-associated up-regulation of adipocyte lysophospholipase D/autotaxin expression.Diabetologia. 2005; 48: 569-577Crossref PubMed Scopus (91) Google Scholar). In vitro, ATX expression and secretion increase during the differentiation of preadipocytes into adipocytes (adipogenesis) (8Gesta S. Simon M.F. Rey A. Sibrac D. Girard A. Lafontan M. Valet P. Saulnier-Blache J.S. Secretion of a lysophospholipase D activity by adipocytes: involvement in lysophosphatidic acid synthesis.J. Lipid Res. 2002; 43: 904-910Abstract Full Text Full Text PDF PubMed Google Scholar, 9Ferry G. Tellier E. Try A. Gres S. Naime I. Simon M.F. Rodriguez M. Boucher J. Tack I. Gesta S. Autotaxin is released from adipocytes, catalyzes lysophosphatidic acid synthesis, and activates preadipocyte proliferation. Up-regulated expression with adipocyte differentiation and obesity.J. Biol. Chem. 2003; 278: 18162-18169Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar). These observations suggested that ATX contributes to fat development in obesity and associated pathologies. In the present study, we set out to disrupt ATX expression specifically in mouse adipose tissue to examine whether fat mass and plasma LPA concentration were affected. We demonstrate that adipocyte-specific disruption of ATX significantly increases the sensitivity of adipose tissue to expand in response to a high-fat diet (HFD) and directly influences plasma LPA levels. Animals were handled in accordance with the principles and guidelines established by the National Institute of Medical Research (INSERM) and were in conformity with the Public Health Service Policy on Humane Care and Use of Laboratory Animals. The local Animal facility committee of INSERM approved our protocols. Mice were housed conventionally under a constant temperature (20–22°C) and humidity (50–60%) and with a 12/12 h light/dark cycle (lights on at 7:00 AM) and free access to food and water. The animals were fed either a normal diet (ND) [2900 kcal/kg: 16% protein, 81% carbohydrate, and 3% fat (SAFE, Augy, France)] or an HFD [4730 kcal/kg: 20% protein, 35% carbohydrate, and 45% fat (Research Diet, France)]. When the HFD was applied, it started at the age of 10 weeks for 13 weeks. Fat and lean mass was measured using dual-energy X-ray absorptiometry (EchoMRI-100TM, Echo Medical System, Houston, TX) in accordance with the manufacturer's instructions. ATXF/F (FVB genetic background) mice carrying a conditional ATX deleted allele in which exons 6 and 7 (encoding for the catalytic site of ATX) are flanked by two loxP sites were previously described (4van Meeteren L.A. Ruurs P. Stortelers C. Bouwman P. van Rooijen M.A. Pradere J.P. Pettit T.R. Wakelam M.J. Saulnier-Blache J.S. Mummery C.L. Autotaxin, a secreted lysophospholipase D, is essential for blood vessel formation during development.Mol. Cell. Biol. 2006; 26: 5015-5022Crossref PubMed Scopus (448) Google Scholar). aP2-Cre mice (B6 genetic background) (Jackson Laboratory) carry a Cre transgene driven by promoter sequences from the fatty acid binding protein 4, a gene predominantly expressed in adipocytes (13He W. Barak Y. Hevener A. Olson P. Liao D. Le J. Nelson M. Ong E. Olefsky J.M. Evans R.M. Adipose-specific peroxisome proliferator-activated receptor gamma knockout causes insulin resistance in fat and liver but not in muscle.Proc. Natl. Acad. Sci. USA. 2003; 100: 15712-15717Crossref PubMed Scopus (794) Google Scholar). ATXF/F mice were mated to aP2-Cre mice and offspring were genotyped in order to select mice bearing both ATXF/F and aP2-Cre alleles (Fig. 1). ATXF/F/aP2-Cre (FATX-KO) mice were compared with control ATXF/F littermates of the same generation. Genotyping was performed by PCR on tail-tip DNA. The presence of the ATXF/F allele was determined by using the primers P583 (5′-TGCTTGAAGTGTGTGCAC-3′) and P584 (5′-TTGAATCCTGAGCAATATGG-3′) yielding 170 bp and 300 bp products for the wild-type and the floxed alleles, respectively (Fig. 1). Cycling conditions were: 34 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s. The presence of the aP2-Cre allele was determined using the primers C001 (5′-ACCAGCCAGCTATCAACTCG-3′) and C002 (5′-TTACATTGGTCCAGCCACC-3′) yielding a 192 bp product. An internal PCR control targeting interleukin-2 gene was performed with primers C003 (5′-CTAGGCCACAGAATTGAAAGATCT-3′) and C004 (5′-GTAGGTGGAAATTCTAGCATCATCC-3′) yielding a 324 bp product. Cycling conditions were: 35 cycles of 94°C for 1 min, 60°C for 2 min, and 72°C for 1 min. Immediately after dissection, adipose tissue was minced and incubated for 30 min at 37°C under shaking in 5ml of Krebs-Ringer buffer supplemented with 1 mg/ml collagenase, 3.5 g/100 ml bovine serum albumin, and 22 mg /100 ml pyruvate. Digested tissue was filtered through a 150 µm screen and floating adipocytes were separated from infranatant, which was centrifuged at 900 g for 20 min in order to get stroma-vascular cells (preadipocytes, endothelial cells, and macrophages) in the pellet. Total RNAs were extracted from tissues and cells using the RNeasy mini kit (Qiagen, GmbH, Hilden, Germany). Total RNA (500 ng) was reverse-transcribed for 60 min at 37°C using Superscript II reverse transcriptase (Invitrogen) in the presence of random hexamers. A minus RT reaction was performed in parallel to ensure the absence of genomic DNA contamination. Real-time PCR was performed starting with 12.5 ng cDNA and 100 to 900 nM specific oligonucleotide primers in a final volume of 20 µl using the Mesa blue QPCR Master Mix for Sybr (Eurogentec). Fluorescence was monitored and analyzed in a StepOnePlus Real-Time PCR system instrument (Applied Biosystems). Analysis of the 18S rRNA was performed in parallel using the RRNA control Taqman Assay Kit (Applied Biosystem) in order to normalize gene expression levels. Results are expressed as follows: 2(Ct18S-Ctgene) where Ct corresponds to the number of cycles needed to generate a fluorescent signal above a predefined threshold. Oligonucleotide primers were designed using the Primer Express software (Applied Biosystems). The sequence of the oligonucleotide primers is listed in Table 1.TABLE 1Sequence of the oligonucleotide primer sets used in RT-PCR analysisPrimer sequence 5′ to 3′Target genesSenseAntisenseATX 6-7TCCGTGCATCGTACATGAAGACAGGACCGCAGTTTCTCAATGATX 1-2TGTTTCGGGTCATACCAGGTAATTCGACTTGCTGTGAATCCTAAGCPPARγ2CTGTTTTATGCTGTTATGGGTGAAAGCACCATGCTCTGGGTCAAFABP4 peroxisome fatty acid binding of differentiation sequence fatty acid peroxisome proliferator-activated receptor in a peroxisome fatty acid binding of differentiation sequence fatty acid peroxisome proliferator-activated receptor of protein from medium were separated on a and on The was for 1 h at temperature in and at in the same supplemented with in ATX was by enhanced system using an was from Immediately after dissection, and subcutaneous fat were in for in and on and to were with an to a were measured with software and was determined as number fat was determined as previously described C.L. Y. Xu M. M.J. activity with fat size but not insulin in PubMed Google Scholar) using the with in mg and in were monitored with a at and min after of mice with LPA was using a as previously described J.S. Girard A. Simon M.F. Lafontan M. Valet P. A and for lysophosphatidic acid Lipid Res. Full Text Full Text PDF PubMed Google Scholar). were extracted from or plasma with an volume of and were into with LPA in the presence of The products of the reaction were separated by and Results are was used to two of ATX were using a set of oligonucleotide primers exons 6 and which are to deleted after When compared with their control FATX-KO mice a strong reduction to on fat in ATX in and white adipose tissue as well as in brown fat tissue (Fig. in ATX was in and (Fig. results were in both and (Fig. Adipose-specific disruption of ATX was using set of PCR primers exons 1 and which are out of the site that of exons 6 and 7 to the of the ATX This was using that a strong reduction in the of ATX protein in white adipose tissue of FATX-KO mice compared with control mice (Fig. In white adipose tissue from control ATX expression was higher in the adipocyte than in the stroma-vascular (Fig. In FATX-KO the disruption of ATX expression was in the adipocyte but not in the stroma-vascular compared with control mice (Fig. These results that in FATX-KO mice an adipocyte-specific disruption of ATX FATX-KO mice and showed in adipose tissue and or in the of other organs and compared with control mice These results show that under disruption of ATX not the normal development of white and brown adipose tissue. HFD, and the of other organs control and FATX-KO 2 and In a of increase in was in FATX-KO compared with control mice In a significantly higher of the white adipose tissue as well as of brown adipose tissue was in FATX-KO compared with control mice (Fig. This was in (Fig. Analysis of using showed that on a HFD, FATX-KO a significantly higher fat mass than control with in lean mass from FATX-KO mice a higher size compared with control mice 6 µm in fat µm in subcutaneous fat In in adipocyte number fat was control and FATX-KO for adipose 2 2 for subcutaneous adipose tissue. Analysis of adipocyte size showed that FATX-KO mice a significantly higher of the adipocytes than and µm in and subcutaneous fat associated with a of adipocytes than and 60 µm in and subcutaneous fat than control mice (Fig. These results show that disruption of ATX the sensitivity of adipose tissue to expand in response to HFD as the of an than an of the and was determined after in a was determined after The in adipose tissue expansion control and FATX-KO mice fed an HFD was associated with in food and for control and FATX-KO that disruption of ATX has on food that a of ATX has to in the FATX-KO mice on an HFD showed in blood compared with control mice Nevertheless, the of the response after an of was in FATX-KO compared with control mice (Fig. This was as by a the reduction of the area under the 34 in FATX-KO and control These results the higher sensitivity of FATX-KO mice to expand fat in response to HFD, is associated with a the of ATX disruption on adipose tissue in we analyzed gene expression in white and brown adipose tissue. enhanced sensitivity of to expand their white adipose tissue in response to an HFD was in than in we our on The expression of peroxisome proliferator-activated receptor adiponectin, and genes was significantly higher in subcutaneous fat from FATX-KO than in control This was on both and HFD conditions (Fig. of subcutaneous fat in either control and FATX-KO mice In to subcutaneous in gene expression was in adipose tissue FATX-KO and control mice (Fig. A and In brown adipose tissue, in gene expression was for leptin, expression of which was higher in FATX-KO compared with control mice in with the higher brown adipose tissue mass (Fig. These results show that adipose disruption of ATX to a in gene expression in subcutaneous white adipose tissue. an FATX-KO mice showed a reduction in plasma LPA compared with control mice (Fig. an HFD, plasma LPA concentration was increased in control mice compared with In in FATX-KO an HFD on plasma LPA concentration (Fig. HFD was associated with an increased expression of ATX in and subcutaneous white adipose tissue of control not in FATX-KO mice (Fig. the of ATX expression by an HFD was in subcutaneous than in fat a in control mice on an HFD, subcutaneous fat LPA than by fat of ATX was not in brown adipose tissue, (Fig. We that white adipose tissue ATX expression significantly influences plasma LPA levels. Our showed that of obesity in mouse and are associated with an of ATX that is to adipose tissue (9Ferry G. Tellier E. Try A. Gres S. Naime I. Simon M.F. Rodriguez M. Boucher J. Tack I. Gesta S. Autotaxin is released from adipocytes, catalyzes lysophosphatidic acid synthesis, and activates preadipocyte proliferation. Up-regulated expression with adipocyte differentiation and obesity.J. Biol. Chem. 2003; 278: 18162-18169Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar, 12Boucher J. Quilliot D. Praderes J.P. Simon M.F. Gres S. Guigne C. Prevot D. Ferry G. Boutin J.A. Carpene C. Potential involvement of adipocyte insulin resistance in obesity-associated up-regulation of adipocyte lysophospholipase D/autotaxin expression.Diabetologia. 2005; 48: 569-577Crossref PubMed Scopus (91) Google Scholar). the of the present was to the specific contribution of adipose tissue ATX in the development of we transgenic mice bearing an of ATX by using a and we compared their to nutritional obesity with control The was on the activity in adipose tissue driven by the C. M. J. H. A. expression of Cre to adipose tissue of transgenic mice of gene Res. PubMed Scopus Google Scholar). Our was because a disruption of ATX was in white and brown adipose tissue but not in other ATX-expressing organs. In we in white adipose tissue from FATX-KO the disruption of ATX was to adipocytes and was not in the stroma-vascular that This is in with the activity of the in adipocytes P. of a adipocyte-specific involvement of an PubMed Scopus Google and that FATX-KO mice an adipocyte-specific disruption of Our was fed an HFD, FATX-KO mice a significantly higher fat mass than control This that disruption of ATX increases the sensitivity of adipose tissue to expand to an HFD, that adipose in a negative of nutritional negative of ATX was not in mice fed an that a of ATX expression to to get a negative of fat ATX expression in control mice is to its that its disruption in FATX-KO mice has on fat In on an HFD, the expression of ATX is increased above the to a on fat mass in FATX-KO to a higher fat mass than in control The expansion of fat mass in response to HFD is to from an increased of adipocytes with the of adipocytes by differentiation of a We previously that the of ATX has an activity that was associated with of a in adipocyte differentiation M.F. D. Pradere J.P. Gres S. Guigne C. M. J. Valet P. Saulnier-Blache J.S. acid adipocyte differentiation via lysophosphatidic acid 1 of peroxisome proliferator-activated receptor Biol. Chem. 2005; Full Text Full Text PDF PubMed Scopus Google Scholar). We that the of FATX-KO mice to expand fat mass in response to an HFD at in from the of the of LPA by adipose tissue. This is by our that subcutaneous adipose tissue from FATX-KO mice an increased expression of and several genes as adiponectin, leptin, and M. M. N. T. Y. M. I. of adiponectin, a and by 2003; PubMed Scopus Google Scholar, C. J.P. D. J.M. S. of in adipocytes by gamma is in cells a gamma for in the to gamma Google Scholar). is increase was in subcutaneous adipose tissue but not in other fat is that in control the by an HFD of ATX expression and LPA production are in subcutaneous than in the of ATX on gene expression is to in subcutaneous than in gene associated with ATX disruption is to in subcutaneous than in is in other ATX via a it was shown that in to subcutaneous fat expansion in response to an HFD not but an increased of adipocytes Y. in and response to high-fat 2009; PubMed Scopus Google Scholar). its involvement in is to increase the of adipocytes by H. I. proliferator-activated receptor gamma and J. 2009; PubMed Scopus Google Scholar). in parallel with its ATX the of adipocytes, for by This is by our that FATX-KO mice have adipocytes and a tolerance than control the present into the contribution of adipose-ATX to plasma LPA levels. ATX is the of plasma LPA (4van Meeteren L.A. Ruurs P. Stortelers C. Bouwman P. van Rooijen M.A. Pradere J.P. Pettit T.R. Wakelam M.J. Saulnier-Blache J.S. Mummery C.L. Autotaxin, a secreted lysophospholipase D, is essential for blood vessel formation during development.Mol. Cell. Biol. 2006; 26: 5015-5022Crossref PubMed Scopus (448) Google Scholar). organs adipose tissue, but their contribution to plasma LPA has been We that plasma LPA is significantly in FATX-KO mice compared with control plasma LPA increases control mice are fed an HFD and is by an of specifically in white adipose tissue. These observations that or ATX in white adipose tissue with plasma LPA we that adipose tissue significantly contributes to plasma In results show that the by which adipose-ATX fat expansion in response to an HFD from a of a local and production of LPA by the adipose tissue. In the present that adipose-ATX fat mass expansion in response to an HFD and contributes to plasma LPA levels. the by which it the of adipose tissue in mice remains to the present the involvement of adipose-ATX in the development of nutritional The and Animal and and for their autotaxin ATXF/F/aP2-Cre high-fat diet lysophosphatidic acid normal diet peroxisome proliferator-activated receptor

Tuberculosis (TB), caused by the airborne bacterial pathogen Mycobacterium tuberculosis, remains a major source of morbidity and mortality worldwide. So far, the study of host-pathogen interactions in TB has mostly focused on the physiology and virulence of the pathogen, as well as on the various innate and adaptive immune compartments of the host. Microbial organisms endogenous to our body, the so-called microbiota, interact not only with invading pathogens, but also with our immune system. Yet, the impact of the microbiota on host defense against M. tuberculosis remains poorly understood. In order to address this question, we adapted a mouse model of microbial dysbiosis based on a combination of wide-spectrum antibiotics. We found that microbiota dysbiosis resulted in an increased early colonization of the lungs by M. tuberculosis during the first week of infection, correlating with an altered diversity of the gut microbiota during this time period. At the cellular level, no significant difference in the recruitment of myeloid cells, including macrophages, dendritic cells and neutrophils, to the lungs could be detected during the first week of infection between microbiota-competent and -deficient mice. At the molecular level, microbiota depletion did not impact the global production of pro-inflammatory cytokines, such as interferon (IFN)γ, tumor necrosis factor (TNF)α and interleukin (IL)-1β in the lungs. Strikingly, a reduced number of mucosal-associated invariant T (MAIT) cells, a population of innate-like lymphocytes whose development is known to depend on the host microbiota, was observed in the lungs of the antibiotics-treated animals after one week of infection. These cells produced less IL-17A in antibiotics-treated mice. Notably, dysbiosis correction through the inoculation of a complex microbiota in antibiotics-treated animals reversed these phenotypes and improved the ability of MAIT cells to proliferate. Altogether, our results demonstrate that the host microbiota contributes to early protection of lung colonization by M. tuberculosis, possibly through sustaining the function(s) of MAIT cells. Our study calls for a better understanding of the impact of the microbiota on host-pathogen interactions in TB. Ultimately, this study may help develop novel therapeutic approaches based on the use of beneficial microbes, or components thereof, to boost anti-mycobacterial immunity.

OBJECTIVE: Ingested glucose is detected by specialized sensors in the enteric/hepatoportal vein, which send neural signals to the brain, which in turn regulates key peripheral tissues. Hence, impairment in the control of enteric-neural glucose sensing could contribute to disordered glucose homeostasis. The aim of this study was to determine the cells in the brain targeted by the activation of the enteric glucose-sensing system. RESEARCH DESIGN AND METHODS: We selectively activated the axis in mice using a low-rate intragastric glucose infusion in wild-type and glucagon-like peptide-1 (GLP-1) receptor knockout mice, neuropeptide Y-and proopiomelanocortin-green fluorescent protein-expressing mice, and high-fat diet diabetic mice. We quantified the whole-body glucose utilization rate and the pattern of c-Fos positive in the brain. RESULTS: Enteric glucose increased muscle glycogen synthesis by 30% and regulates c-Fos expression in the brainstem and the hypothalamus. Moreover, the synthesis of muscle glycogen was diminished after central infusion of the GLP-1 receptor (GLP-1Rc) antagonist Exendin 9-39 and abolished in GLP-1Rc knockout mice. Gut-glucose-sensitive c-Fos-positive cells of the arcuate nucleus colocalized with neuropeptide Y-positive neurons but not with proopiomelanocortin-positive neurons. Furthermore, high-fat feeding prevented the enteric activation of c-Fos expression. CONCLUSIONS: We conclude that the gut-glucose sensor modulates peripheral glucose metabolism through a nutrient-sensitive mechanism, which requires brain GLP-1Rc signaling and is impaired during diabetes.